Checking whether a string consists of two repetitions - c

I am writing a function that returns 1 if a string consists of two repetitions, 0 otherwise.
Example: If the string is "hellohello", the function will return 1 because the string consists of the same two words "hello" and "hello".
The first test I did was to use a nested for loop but after a bit of reasoning I thought that the idea is wrong and is not the right way to solve, here is the last function I wrote.
It is not correct, even if the string consists of two repetitions, it returns 0.
Also, I know this problem could be handled differently with a while loop following another algorithm, but I was wondering if it could be done with the for as well.
My idea would be to divide the string in half and check it character by character.
This is the last function I tried:
int doubleString(char *s){
int true=1;
char strNew[50];
for(int i=0;i<strlen(s)/2;i++){
strNew[i]=s[i];
}
for(int j=strlen(s)/2;j<strlen(s);j++){
if(!(strNew[j]==s[j])){
true=0;
}
}
return true;
}

The problem in your function is with the comparison in the second loop: you are using the j variable as an index for both the second half of the given string and for the index in the copied first half of that string. However, for that copied string, you need the indexes to start from zero – so you need to subtract the s_length/2 value from j when accessing its individual characters.
Also, it is better to use the size_t type when looping through strings and comparing to the results of functions like strlen (which return that type). You can also improve your code by saving the strlen(s)/2 value, so it isn't computed on each loop. You can also dispense with your local true variable, returning 0 as soon as you find a mismatch, or 1 if the second loop completes without finding such a mismatch:
int doubleString(char* s)
{
char strNew[50] = { 0, };
size_t full_len = strlen(s);
size_t half_len = full_len / 2;
for (size_t i = 0; i < half_len; i++) {
strNew[i] = s[i];
}
for (size_t j = half_len; j < full_len; j++) {
if (strNew[j - half_len] != s[j]) { // x != y is clearer than !(x == y)
return 0;
}
}
return 1;
}
In fact, once you have appreciated why you need to subtract that "half length" from the j index of strNew, you can remove the need for that temporary copy completely and just use the modified j as an index into the original string:
int doubleString(char* s)
{
size_t full_len = strlen(s);
size_t half_len = full_len / 2;
for (size_t j = half_len; j < full_len; j++) {
if (s[j - half_len] != s[j]) { // x != y is clearer than !(x == y)
return 0;
}
}
return 1;
}

This loop
for(int j=strlen(s)/2;j<strlen(s);j++){
if(!(strNew[j]==s[j])){
true=0;
}
}
is incorrect. The index in the array strNew shall start from 0 instead of the value of the expression strlen( s ) / 2.
But in any case your approach is incorrect because at least you are using an intermediate array with the magic number 50. The user can pass to the function a string of any length.
char strNew[50];
The function can look much simpler.
For example
int doubleString( const char *s )
{
int double_string = 0;
size_t n = 0;
if ( ( double_string = *s != '\0' && ( n = strlen( s ) ) % 2 == 0 ) )
{
double_string = memcmp( s, s + n / 2, n / 2 ) == 0;
}
return double_string;
}
That is the function at first checks that the passed string is not empty and its length is an even number. If so then the function compares two halves of the string.
Here is a demonstration program.
#include <stdio.h>
#include <string.h>
int doubleString( const char *s )
{
int double_string = 0;
size_t n = 0;
if (( double_string = *s != '\0' && ( n = strlen( s ) ) % 2 == 0 ))
{
double_string = memcmp( s, s + n / 2, n / 2 ) == 0;
}
return double_string;
}
int main( void )
{
printf( "doubleString( \"\" ) = %d\n", doubleString( "" ) );
printf( "doubleString( \"HelloHello\" ) = %d\n", doubleString( "HelloHello" ) );
printf( "doubleString( \"Hello Hello\" ) = %d\n", doubleString( "Hello Hello" ) );
}
The program output is
doubleString( "" ) = 0
doubleString( "HelloHello" ) = 1
doubleString( "Hello Hello" ) = 0
Pay attention to that the function parameter should have the qualifier const because the passed string is not changed within the function. And you will be able to call the function with constant arrays without the need to defined one more function for constant character arrays.

it's better to do it with a while loop since you don't always have to iterate through all the elements of the string but since you want the for loop version here it is (C++ version):
int doubleString(string s){
int s_length = s.length();
if(s_length%2 != 0) {
return 0;
}
for (int i = 0; i < s_length/2; i++) {
if (s[i] != s[s_length/2 + i]){
return 0;
}
}
return 1;
}

Related

Inconsistent output given by same code on different C compilers

Different compilers are giving different outputs for the same logic in my algorithm.
I wrote the following code for a C code exercise.
The code checks for the longest string in a string vector.
But the same logic gives two different outputs.
Here's what is happening. I have no idea what I did wrong.
First version - without a printf() inside the if condition
Here the if (j > longest) just attributes new values for int longest and int index.
#include <stdio.h>
int main(void) {
char *vs[] = {"jfd", "kj", "usjkfhcs", "nbxh", "yt", "muoi", "x", "rexhd"};
int longest, index = 0;
/* i is the index for elements in *vs[].
* "jfd" is 0, "kj" is 1... */
for (int i = 0; i < sizeof(*vs); i++) {
/* j if the index for string lengths in vs[].
* for "jfd", 'j' is 0, 'f' is 1... */
for (int j = 0; vs[i][j] != '\0'; j++) {
/* if j is longer than the previous longest value */
if (j > longest) {
longest = j;
index = i;
}
}
}
printf("Longest string = %s\n", vs[index]);
return 0;
}
I ran it on https://replit.com/. It gave the unexpected output for longest string of "jfd". https://replit.com/#Pedro-Augusto33/Whatafuck-without-printf?v=1
Second version - with a printf() inside the if condition
Now I just inserted a printf() inside the if (jf > longest) condition, as seen in the code block bellow.
It changed the output of my algorithm. I have no idea how or why.
#include <stdio.h>
int main(void) {
char *vs[] = {"jfd", "kj", "usjkfhcs", "nbxh", "yt", "muoi", "x", "rexhd"};
int longest, index = 0;
/* i is the index for elements in *vs[].
* "jfd" is 0, "kj" is 1... */
for (int i = 0; i < sizeof(*vs); i++) {
/* j if the index for string lengths in vs[].
* for "jfd", 'j' is 0, 'f' is 1... */
for (int j = 0; vs[i][j] != '\0'; j++) {
/* if j is longer than the previous longest value */
if (j > longest) {
printf("Whatafuck\n");
longest = j;
index = i;
}
}
}
printf("Longest string = %s\n", vs[index]);
return 0;
}
I also ran it on https://replit.com/. It gave the expected output for longest string of "usjkfhcs". https://replit.com/#Pedro-Augusto33/Whatafuck-with-printf?v=1
Trying new compilers
After replit.com giving two different outputs, I tried another compiler to check if it also behaved strangely. https://www.onlinegdb.com/online_c_compiler gives random outputs. Sometimes it's "jfd", sometimes it's "usjkfhcs". https://onlinegdb.com/iXoCDDena
Then I went to https://www.programiz.com/c-programming/online-compiler/ . It always gives the expected output of "usjkfhcs".
So, my question is: why are different compilers behaving so strangely with my algorithm? Where is the flaw of my algorithm that makes the compilers interpret it different?
The code does not make sense.
For starters the variable longest was not initialized
int longest, index = 0;
So using it for example in this statement
if (j > longest) {
invokes undefined behavior.
In this for loop
for (int i = 0; i < sizeof(*vs); i++) {
the expression sizeof( *vs ) is equivalent to expression sizeof( char * ) and yields either 4 or 8 depending on the used system. It just occurred such a way that the array was initialized with 8 initializers. But in any case the expression sizeof( *vs ) does not provide the number of elements in an array and its value does not depend on the actual number of elements.
Using the if statement within the for loop in each iteration of the loop
for (int j = 0; vs[i][j] != '\0'; j++) {
/* if j is longer than the previous longest value */
if (j > longest) {
longest = j;
index = i;
}
}
Also does not make sense. It does not calculate the exact length of a string that is equal to j after the last iteration of the loop. So in general such a loop shall not be used for calculating length of a string.
Consider a string for example like "A". Using this for loop you will get that its length is equal to 0 while its length is equal to 1..
It seems you are trying to find the longest string a pointer to which stored in the array.
You could just use standard C string function strlen declared in header <string.h>. If to use your approach with for loops then the code can look the following way
#include <stdio.h>
int main(void)
{
const char *vs[] = { "jfd", "kj", "usjkfhcs", "nbxh", "yt", "muoi", "x", "rexhd" };
const size_t N = sizeof( vs ) / sizeof( *vs );
size_t longest = 0, index = 0;
for ( size_t i = 0; i < N; i++ )
{
size_t j = 0;
while ( vs[i][j] != '\0' ) ++j;
if ( longest < j )
{
longest = j;
index = i;
}
}
printf( "Longest string = %s\n", vs[index] );
printf( "Its length = %zu\n", longest );
return 0;
}

How does a recursive code determine if palindrome work?

I have a problem question and a snippet code below. The snippet is filled already because I found out the solution but I do not understand why it is like that. Could you help me explain how the codes work?
Problem: Ten tiles each have strings of in between 1 and 4 letters on them (hardcoded in the code below). The goal of this problem is to complete the code below so it counts the number of different orders in which all of the tiles can be placed such that the string they form creates a palindrome (a word that reads the same forwards and backwards). All of main, as well as the function eval which determines if a particular ordering of the tiles forms a palindrome. You may call this function in the function go. Complete the recursive function (named go) to complete the solution.
Snippet code:
#include <stdio.h>
#include <string.h>
#define N 10
#define MAXLEN 5
int go(int perm[], int used[], int k, char tiles[N][MAXLEN]);
int eval(int perm[], char tiles[N][MAXLEN]);
char MYTILES[N][MAXLEN] = {
"at", "ta", "g", "cc", "ccac", "ca", "cc", "gag", "cga", "gc"
};
int
main(void)
{
int perm[N];
int used[N];
for (int i = 0; i < N; i++)
used[i] = 0;
int res = go(perm, used, 0, MYTILES);
printf("Number of tile orderings that create palindromes is %d\n", res);
return 0;
}
int
go(int perm[], int used[], int k, char tiles[N][MAXLEN])
{
if (k == N)
return eval(perm, tiles);
int res = 0;
for (int i = 0; i < N; i++) {
if (used[i])
continue;
used[i] = 1;
perm[k] = i;
res += go(perm, used, k + 1, tiles);
used[i] = 0;
}
return res;
}
int
eval(int perm[], char tiles[N][MAXLEN])
{
char tmp[N * MAXLEN];
int idx = 0;
for (int i = 0; i < N; i++) {
int len = strlen(tiles[perm[i]]);
for (int j = 0; j < len; j++)
tmp[idx++] = tiles[perm[i]][j];
}
tmp[idx] = '\0';
for (int i = 0; i < idx / 2; i++)
if (tmp[i] != tmp[idx - 1 - i])
return 0;
return 1;
}
Thank you. I appreciate all help!!
To understand this code, add the following line to the start of eval():
for( int j = 0; j < N; j++ ) printf( "%d ", perm[j] ); putchar('\n');
The for() loop in go() causes a recursion that is 10 levels deep, ultimately generating 10! (~3.6 million) permutations of the 10 indices from 0 to 9. In sequence, each of those permutations is used to concatenate the 'tokens' (the short ACTG variations) into a single string that is then tested for being palindromic by `eval()'
This is called a "brute force" search through the possibility space.
Below I've revised the code to be slightly more compact, adding two "printf debugging" lines (marked "/**/") that report what the program is doing. You'll need some patience if you wish to watch millions of permutations of 0 to 9 scroll by, or simply comment out that line and recompile. I also shuffled things around and made the two interesting arrays global instead of "whacking the stack" by passing them up/down the recursion. Less code is better. This program is "single purpose". The clarity gained justifies using global variables in this instance, imho.
More interesting is the additional puts() line that reports the palindromic sequences.
#include <stdio.h>
#include <string.h>
#define N 10
#define MAXLEN 5
char MYTILES[N][MAXLEN] = { "AT","TA","G","CC","CCAC","CA","CC","GAG","CGA","GC" };
int perm[N], used[N] = { 0 };
int go( int k ) {
if (k == N) {
// At extent of recursion here.
/**/ for( int j = 0; j < k; j++ ) printf( "%d ", perm[j] ); putchar('\n');
// Make a string in this sequence
char tmp[N*MAXLEN] = {0};
for( int i = 0; i < N; i++ )
strcat( tmp, MYTILES[ perm[ i ] ] );
// Test string for being palidromic
for( int l = 0, r = strlen( tmp ) - 1; l <= r; l++, r-- )
if( tmp[l] != tmp[r] )
return 0; // Not palidrome
/**/ puts( tmp );
return 1; // Is palidrome
}
// recursively generate permutations here
int res = 0;
for( int i = 0; i < N; i++ )
if( !used[i] ) {
used[i] = 1;
perm[k] = i;
res += go( k+1 );
used[i] = 0;
}
return res;
}
int main( void ) {
printf( "Palindromic tile orderings: %d\n", go( 0 ) );
return 0;
}
An immediate 'speed-up' would be to test that the first letter of the 0th string to be permuted matches the last letter of the 9th string... Don't bother concatenating if a palindrome is impossible from the get-go. Other optimisations are left as an exercise for the reader...
BTW: It's okay to make a copy of code and add your own print statements so that the program reports what it is doing when... Or, you could single-step through a debugger...
UPDATE
Having added a preliminary generation of a 10x10 matrix to 'gate' the workload of generating strings to be checked as palindromic, with the 10 OP supplied strings, it turns out that 72% of those operations were doomed to fail from the start. Of the 3.6 million "brute force" attempts, a quick reference to this pre-generated matrix prevented about 2.6 million of them.
It's worthwhile trying to make code efficient.
UPDATE #2:
Bothered that there was still a lot of 'fat' in the execution after trying to improve on the "brute force" in a simple way, I've redone some of the code.
Using a few extra global variables (the state of processing), the following now does some "preparation" in main(), then enters the recursion. In this version, once the string being assembled from fragments is over half complete (in length), it is checked from the "middle out" if it qualifies as being palindromic. If so, each appended fragment causes a re-test. If the string would never become a palindrome, the recursion 'backs-up' and tries another 'flavour' of permutation. This trims the possibility space immensely (and really speeds up the execution.)
char *Tiles[] = { "AT","TA","G","CC","CCAC","CA","CC","GAG","CGA","GC" };
const int nTiles = sizeof Tiles/sizeof Tiles[0];
int used[ nTiles ];
char buildBuf[ 1024 ], *cntrL, *cntrR; // A big buffer and 2 pointers.
int fullLen;
int cntTested, goCalls; // some counters to report iterations
uint32_t factorial( uint32_t n ) { // calc n! (max 12! to fit uint32_t)
uint32_t f = 1;
while( n ) f *= n--;
return f;
}
int hope() { // center outward testing for palindromic characteristics
int i;
for( i = 0; cntrL[ 0 - i ] == cntrR[ 0 + i ]; i++ ) ; // looping
return cntrR[ 0 + i ] == '\0';
}
int go( int k ) {
goCalls++;
if( k == nTiles ) { // at full extent of recursion here
// test string being palindromic (from ends toward middle for fun)
cntTested++;
for( int l = 0, r = fullLen - 1; l <= r; l++, r-- )
if( buildBuf[l] != buildBuf[r] )
return 0; // Not palindrome
/**/ puts( buildBuf );
return 1; // Is palindrome
}
// recursively generate permutations here
// instead of building from sequence of indices
// this builds the (global) sequence string right here
int res = 0;
char *at = buildBuf + strlen( buildBuf );
for( int i = 0; i < nTiles; i++ )
if( !used[i] ) {
strcpy( at, Tiles[ i ] );
// keep recursing until > half assembled and hope persists
if( at < cntrL || hope() ) {
used[i] = 1;
res += go( k+1 ); // go 'deeper' in the recursion
used[i] = 0;
}
}
return res;
}
int main( void ) {
for( int i = 0; i < nTiles; i++ )
fullLen += strlen( Tiles[i] );
if( fullLen % 2 == 0 ) // even count
cntrR = (cntrL = buildBuf + fullLen/2 - 1) + 1; // 24 ==> 0-11 & 12->23
else
cntrR = cntrL = buildBuf + fullLen/2; // 25 ==> 0-12 & 12->24
printf( "Palindromic tile orderings: %d\n", go( 0 ) );
printf( "Potential: %d\n", factorial( nTiles ) );
printf( "Calls to go(): %d\n", goCalls );
printf( "Actual: %d\n", cntTested );
return 0;
}
ATCCACGAGCCGCCGAGCACCTA
ATCCACGAGCCGCCGAGCACCTA
ATCCACGCCGAGAGCCGCACCTA
ATCCACGCCGAGAGCCGCACCTA
ATCACCGAGCCGCCGAGCCACTA
ATCACCGCCGAGAGCCGCCACTA
ATCACCGAGCCGCCGAGCCACTA
ATCACCGCCGAGAGCCGCCACTA
TACCACGAGCCGCCGAGCACCAT
TACCACGAGCCGCCGAGCACCAT
TACCACGCCGAGAGCCGCACCAT
TACCACGCCGAGAGCCGCACCAT
TACACCGAGCCGCCGAGCCACAT
TACACCGCCGAGAGCCGCCACAT
TACACCGAGCCGCCGAGCCACAT
TACACCGCCGAGAGCCGCCACAT
CCACATGAGCCGCCGAGTACACC
CCACATGAGCCGCCGAGTACACC
CCACATGCCGAGAGCCGTACACC
CCACATGCCGAGAGCCGTACACC
CCACTAGAGCCGCCGAGATCACC
CCACTAGAGCCGCCGAGATCACC
CCACTAGCCGAGAGCCGATCACC
CCACTAGCCGAGAGCCGATCACC
CACCATGAGCCGCCGAGTACCAC
CACCATGCCGAGAGCCGTACCAC
CACCTAGAGCCGCCGAGATCCAC
CACCTAGCCGAGAGCCGATCCAC
CACCATGAGCCGCCGAGTACCAC
CACCATGCCGAGAGCCGTACCAC
CACCTAGAGCCGCCGAGATCCAC
CACCTAGCCGAGAGCCGATCCAC
Palindromic tile orderings: 32
Potential: 3628800
Calls to go(): 96712
Actual: 32
UPDATE #3 (having fun)
When there's too much code, and an inefficient algorithm, it's easy to get lost and struggle to work out what is happening.
Below produces exactly the same results as above, but shaves a few more operations from the execution. In short, go() is called recursively until at least 1/2 of the candidate string has been built-up. At that point, hope() is asked to evaluate the string "from the middle, out." As long as the conditions of being palindromic (from the centre, outward) are being met, that evaluation is repeated as the string grows (via recursion) toward its fullest extent. It is the "bailing-out early" that makes this version far more efficient than the OP version.
One further 'refinement' is that the bottom of the recursion is found without an extra call to \0. Once one has the concepts of recursion and permutation, this should all be straight forward...
char *Tiles[] = { "AT", "TA", "G", "CC", "CCAC", "CA", "CC", "GAG", "CGA", "GC" };
const int nTiles = sizeof Tiles/sizeof Tiles[0];
int used[ nTiles ];
char out[ 1024 ], *cntrL, *cntrR;
int hope() { // center outward testing for palidromic characteristics
char *pL = cntrL, *pR = cntrR;
while( *pL == *pR ) pL--, pR++;
return *pR == '\0';
}
int go( int k ) {
int res = 0;
char *at = out + strlen( out );
for( size_t i = 0; i < nTiles; i++ )
if( !used[i] ) {
strcpy( at, Tiles[ i ] );
if( at >= cntrL && !hope() ) // abandon this string?
continue;
if( k+1 == nTiles ) { // At extent of recursion here.
puts( out );
return 1;
}
used[i] = 1, res += go( k+1 ), used[i] = 0;
}
return res;
}
int main( void ) {
int need = 0;
for( size_t i = 0; i < nTiles; i++ )
need += strlen( Tiles[ i ] );
cntrL = cntrR = out + need/2; // odd eg: 25 ==> 0-12 & 12->24
cntrL -= (need % 2 == 0 ); // but, if even eg: 24 ==> 0-11 & 12->23
printf( "Palindromic tile orderings: %d\n", go( 0 ) );
return 0;
}

C: Problem in comparing two strings in a function

Good morning everyone, I have to simulate the operation of the strstr() function with a function written by me.
In the code I slide the original string in a temporary string and then the comparison with the string to look for, if they are equal it should return 1.
But even if the strings are equal and of the same length the code never enters the if cycle and therefore never returns 1.
My code:
int *strstr_new(char *s7, char *s8) {
int length_s7 = strlen(s7);
int length_s8 = strlen(s8);
char search_string[length_s8];
printf("%d\n", length_s8);
for(int i=0; i<length_s7; i++) {
for(int j=0; j<length_s8; j++) {
search_string[j] = s7[i+j];
search_string[j+1] = '\0';
}
printf("%s\n", s8);
printf("%s\n", search_string);
printf("%d\n", length_s8);
printf("%d\n", strlen(search_string));
//search_string[length_s8+1] = '\0';
if(search_string == s8) {
return(1);
}
}
if(search_string != s8) {
return(NULL);
}}
Does someone have an idea of where I'm wrong?
Thanks!
The function declaration
int *strstr_new(char *s7, char *s8);
looks very strange.
For example why is the return type int *?
Why are function parameters named s7 and s8 instead of for example s1 and s2?
Why are not the function parameters qualified with const?
Creating a variable length array within the function is inefficient and redundant and can lead to stack exhaustion.
char search_string[length_s8];
This loops
for(int j=0; j<length_s8; j++) {
search_string[j] = s7[i+j];
search_string[j+1] = '\0';
}
invokes undefined behavior because this statement
search_string[j+1] = '\0';
writes beyond the array when j is equal to length_s8 - 1.
In this statement
if(search_string == s8) {
there are compared two pointers and it is evident that they are unequal because they point to different arrays.
Without using standard C functions except the function strlen (that could be also defined explicitly) the function can be declared and defined the following way
#include <stdio.h>
#include <string.h>
char * strstr_new( const char *s1, const char *s2 )
{
char *p = NULL;
size_t n1 = strlen( s1 );
size_t n2 = strlen( s2 );
if ( !( n1 < n2 ) )
{
for ( size_t i = 0, n = n1 - n2 + 1; p == NULL && i < n; i++ )
{
size_t j = 0;
while ( j < n2 && s1[i + j] == s2[j] ) ++j;
if ( j == n2 ) p = ( char * )( s1 + i );
}
}
return p;
}
int main( void )
{
const char *s1 = "strstr_new";
const char *s2 = "str";
for ( const char *p = s1; ( p = strstr_new( p, s2 ) ) != NULL; ++p )
{
puts( p );
}
}
The program output is
strstr_new
str_new
If you are allowed to use standard string functions along with strlen then the loop within the function strstr_new can be simplified the following way
for ( size_t i = 0, n = n1 - n2 + 1; p == NULL && i < n; i++ )
{
if ( memcmp( s1 + i, s2, n2 ) == 0 ) p = ( char * )( s1 + i );
}
The biggest problem in your code is comparing strings with == operator. Both search_string and s8 are char pointers, which means you're comparing addresses of different variables, obviously to return False. Try adding another for loop to compare each char in search_string to the corresponding char in s8 (using the dereferencing operator *).
Your string comparisons won't work because you are comparing the addresses of those strings instead of the strings themselves, you'd what to use something like strcmp or memcmp to compare two strings.
Your return type is also not compatible with the return you have particularly if the strings match. I'd return 1 if the string is found and 0 if it's not, for that you'd need to change the return type to int only.
The second string comparison is unneeded, you already test the existance of the substring inside the loop so you just need to return 0 if the loop finds it's way to the end.
Lastly the temporary string is too short and will allow for access outside its bounds, inside the loop.
e.g. if length_s8 is 4 will write to
search_string[4], 5th index, out the bounds of the array.
int strstr_new(char *s7, char *s8) //return 1 for found, 0 for not found
{
int length_s7 = strlen(s7);
int length_s8 = strlen(s8);
char search_string[length_s8 + 1];//you'd want to avoid buffer overflow
for (int i = 0; i < length_s7; i++)
{
for (int j = 0; j < length_s8; j++)
{
search_string[j] = s7[i + j];
search_string[j + 1] = '\0';
}
if (!strcmp(search_string, s8))
{
return 1; //if the string is found return 1 immediately
}
}
return 0; //if it reaches this point, no match was found
}
A couple of tests:
printf("%d\n", strstr_new("this is my string", "this i"));
printf("%d\n", strstr_new("this is my string", "ringo"));
printf("%d\n", strstr_new("this is my string", "ring"));
printf("%d\n", strstr_new("this is my strin", "ths"));
Output:
1
0
1
0

Varying arguments for if () statement

I have a problem as stated below:
i have an array(say) a[]={10,24,56,33,22,11,21}
i have something like this
for(i=0;i<100;i++){
if(a[i]==10)
// do something
}
next when i=1
if(a[i]==10 && a[i+1]==24)
so on so at each iteration the arguments / conditions within if should be varying
now this will be a very big sequence i cant explicitly write
if(a[i]==10 && a[i+1]==24 && a[i+2]==56 ...... a[i+100]=2322)
how can i achieve this varying conditions?
You have to have a cumulative "boolean" variable that checks a[i] at the i-th iteration and update that variable:
int a[] = {...}; /* array with some values to verify */
int v[] = {...}; /* these are the actual desired values in a[] */
/* the verifying loop */
int i;
int cond = 1;
for (i = 0; i < 100; i++)
{
cond = cond && (a[i] == v[i]);
if (cond)
{
/* do something */
}
}
I think that you should introduce a boolean value.
bool valid = true;
for(i=0;i<100;i++){
if(a[i]==10 && valid)
// do something
else
{
valid = false;
break;
}
}
For every iteration, you need to change the value to which you are comparing a[i]
Have a loop within a loop:
for (i = 0; i != 100; ++i)
{
int condition = 1;
for (j = 0; i + j != 100 && condition; ++j)
{
condition = condition && (a[i + j] == /* your number */ );
}
if (condition) { /* ... */ }
}
In this case, you can use function pointers or blocks.
You can find a good example here here
Seeing your examples, I think that the variations you are talking about is only in the length of array 'a' whose presence you want to check in some array x. If indeed it is so, memcmp can be of use to you.
Let me modify your example a bit to clarify what I am saying.
int a[7]={10,24,56,33,22,11,21} is the required values you want to check in some array 'x', with different lengths of 'a' each time, with 'x' declared as
int x[1000];
In that case, you could use memcmp as follow :-
for ( len = 1 ; len <= 7 ; ++len )
{ for ( i = 0 ; i <= 1000-len ; ++i )
{ if ( ! memcmp( a, x+i, len * sizeof(int) ) )
{ // do something
}
}
}

Finding unique elements in an string array in C

C bothers me with its handling of strings. I have a pseudocode like this in my mind:
char *data[20];
char *tmp; int i,j;
for(i=0;i<20;i++) {
tmp = data[i];
for(j=1;j<20;j++)
{
if(strcmp(tmp,data[j]))
//then except the uniqueness, store them in elsewhere
}
}
But when i coded this the results were bad.(I handled all the memory stuff,little things etc.) The problem is in the second loop obviously :D. But i cannot think any solution. How do i find unique strings in an array.
Example input : abc def abe abc def deg entered
unique ones : abc def abe deg should be found.
You could use qsort to force the duplicates next to each other. Once sorted, you only need to compare adjacent entries to find duplicates. The result is O(N log N) rather than (I think) O(N^2).
Here is the 15 minute lunchtime version with no error checking:
typedef struct {
int origpos;
char *value;
} SORT;
int qcmp(const void *x, const void *y) {
int res = strcmp( ((SORT*)x)->value, ((SORT*)y)->value );
if ( res != 0 )
return res;
else
// they are equal - use original position as tie breaker
return ( ((SORT*)x)->origpos - ((SORT*)y)->origpos );
}
int main( int argc, char* argv[] )
{
SORT *sorted;
char **orig;
int i;
int num = argc - 1;
orig = malloc( sizeof( char* ) * ( num ));
sorted = malloc( sizeof( SORT ) * ( num ));
for ( i = 0; i < num; i++ ) {
orig[i] = argv[i + 1];
sorted[i].value = argv[i + 1];
sorted[i].origpos = i;
}
qsort( sorted, num, sizeof( SORT ), qcmp );
// remove the dups (sorting left relative position same for dups)
for ( i = 0; i < num - 1; i++ ) {
if ( !strcmp( sorted[i].value, sorted[i+1].value ))
// clear the duplicate entry however you see fit
orig[sorted[i+1].origpos] = NULL; // or free it if dynamic mem
}
// print them without dups in original order
for ( i = 0; i < num; i++ )
if ( orig[i] )
printf( "%s ", orig[i] );
free( orig );
free( sorted );
}
char *data[20];
int i, j, n, unique[20];
n = 0;
for (i = 0; i < 20; ++i)
{
for (j = 0; j < n; ++j)
{
if (!strcmp(data[i], data[unique[j]]))
break;
}
if (j == n)
unique[n++] = i;
}
The indexes of the first occurrence of each unique string should be in unique[0..n-1] if I did that right.
Why are you starting second loop from 1?
You should start it from
i+1. i.e.
for(j=i+1;j<20;j++)
Like if the list is
abc
def
abc
abc
lop
then
when i==4
tmp="lop"
but then the second loop starts which is from 1 to 19. This means it will get a value of 4 too at one stage, and then
data[4], which is "lop", will be same as tmp. So although "lop" is unique but it will be flagged as repeated.
Hope it was helpful.
Think a bit more about your problem -- what you really want to do is look at the PREVIOUS strings to see if you've already seen it. So, for each string n, compare it to strings 0 through n-1.
print element 0 (it is unique)
for i = 1 to n
unique = 1
for j = 0 to i-1 (compare this element to the ones preceding it)
if element[i] == element[j]
unique = 0
break from loop
if unique, print element i
Might it be that your test is if (strcmp (this, that)) which will succeed if the two are different? !strcmp is probably what you want there.

Resources