I have multiple array, number can be arbitrary. but the size of all array is same. How do i add each element of with respective element of all the arrays and maybe save it in another array
A1 = [1 2 3 4 5 6]
A2 = [1 2 3 4 5 6]
.
.
.
.
final = [1+1+1+... 2+2+2+.... 3+3+3+3.... 4+4+4.... 5+5+5+5... 6+6+6+6...]
As your arrays are all the same length you can just add the arrays forming a new array.
final = A1+A2
This function searches in your workspace looking for all variables containing capital 'A'. The for loop adds all found variables. If there are other variables containing 'A', other restrictions has to be made.
variables = who %# all variable names from workspace
index = strmatch('A',variables) %# indices matching "A"
newarray = 0
for j = 1:numel(index)
tmp = eval(char(variables(index(j)))); %# store variable in tmp
newarray = newarray + tmp; %# sum
end
If you have an unknown number of A's, you can try something like this:
final = 0
i = 1
while exist(['A' num2str(i)]) == 1 % ['A' num2str(i)] constructs the variable name, eval calls it
final = final + eval(['A' num2str(i)]);
i = i + 1;
end
This should work as long as the variables are stored in the workspace, are of the same length and are named A1, A2, A3, ... A9, A10, ...
Let's say you have this structure (as you write in the comments):
main = struct('err',{1:6,5:10,1:6,1:6},'seg_err',{1:6,5:10,1:6,5:10});
you can convert it to matrix:
m = vertcat(main.seg_err);;
And than take the sum in a simple command:
final = sum(m)
which results:
final =
12 16 20 24 28 32
and thanks to #beaker :)
Related
The following code generates an cell array Index [1x29], where each cell is an array [29x6]:
for i = 1 : size(P1_cell,1)
for j = 1 : size(P1_cell,2)
[Lia,Lib] = ismember(P1_cell{i,j},PATTERNS_FOR_ERANOS_cell{1},'rows');
Index1(i,j) = Lib % 29x6
end
Index{i} = Index1; % 1x29
end
How can I find the nonzero values in Index array?, i.e. generate an array with the number of non-zero values in each row of the Index1 array. I tried the following loop, but it doesn't work, it creates conflict with the previous one:
for i = 1 : length(Index)
for j = 1 : length(Index)
Non_ceros = length(find(Index{:,i}(j,:))); %% I just need the length of the find function output
end
end
I need help, Thanks in advance.
The nnz() (number of non-zeros) function can be used to evaluate the number of non-zero elements. To obtain the specific positive values you can index the array by using the indices returned by the find() function. I used some random test data but it should work for 29 by 6 sized arrays as well.
%Random test data%
Index{1} = [5 2 3 0 zeros(1,25)];
Index{2} = [9 2 3 1 zeros(1,25)];
Index{3} = [5 5 5 5 zeros(1,25)];
%Initializing and array to count the number of zeroes%
Non_Zero_Counts = zeros(length(Index),1);
for Row_Index = 1: length(Index)
%Evaluating the number of positive values%
Array = Index{Row_Index};
Non_Zero_Counts(Row_Index) = nnz(Array);
%Retrieving the positive values%
Positive_Indices = find(Array);
PositiveElements{Row_Index} = Array(Positive_Indices);
disp(Non_Zero_Counts(Row_Index) + " Non-Zero Elements ");
disp(PositiveElements{Row_Index});
end
Ran using MATLAB R2019b
for i = 1 : length(Index)
for j = 1 : length(Index)
Non_ceros(i,j) = nnz(Index{:,i}(j,:));
end
end
Two questions, one fairly simple question (at least it seems it should be simple) and one that may take a bit more work. Feel free to contribute to either or both.
First, I'd like to create a string array based off of an existing string array based on a criteria. Take for example a similar operation with a double array:
>> nums = [ 1 2 1 2]
nums =
1 2 1 2
>> big_nums = (nums == 2) .* nums
big_nums =
0 2 0 2
I'd like to do something similar with a string array, however I don't know what function to use:
>> sizes = ["XL" "L" "XL" "L"]
sizes =
1×4 string array
"XL" "L" "XL" "L"
>> large_sizes = (sizes == "L") .* sizes
Undefined operator '.*' for input arguments of type 'string'.
I'd like the output to be
large_sizes =
1×4 string array
"" "L" "" "L"
Second question. Suppose I have a 2 dimensional cell array. I'd like to filter data based on criteria:
>> data = {"winter", 1; "spring", 2; "summer", 3; "fall", 4}
data =
4×2 cell array
["winter"] [1]
["spring"] [2]
["summer"] [3]
["fall" ] [4]
>> nice_weather = ( (data(1,:) == "fall") + (data(1,:) == "spring") ) .* data
Error using ==
Cell must be a cell array of character vectors.
I'd like a code that results in one of two arrays:
nice_weather =
4×2 cell array
[""] [1]
["spring"] [2]
[""] [3]
["fall"] [4]
----- OR -----
nice_weather =
2×2 cell array
["spring"] [2]
["fall"] [4]
For this question, I am also open to separating data into multiple arrays (for example, one array for strings and one array for numbers).
Thanks!
This solution uses the strcmpi function from MATLAB (no toolbox required) to compare two strings (insensitive to the case).
1D Cell Array:
sizes = {'XL' 'L' 'XL' 'L'}; % Changed " to ' & used cell array
idx = strcmpi(sizes,'L'); % Logical index
sizelist = {sizes{idx}}
Or you could try something like
sizes(~idx) = {"" ""} % manual just for example
For this to automatically adjust the number of blanks "", you could use repmat like this
sizes(~idx) = repmat({""},1,sum(~idx))
Output:
sizes = 1×4 cell array
{[""]} {'L'} {[""]} {'L'}
2D Cell Array:
data = {'winter', 1; 'spring', 2; 'summer', 3; 'fall', 4}; % Changed " to '
nicemo1 = 'spring';
nicemo2 = 'fall';
idx = strcmpi(data(:,1),nicemo1) | strcmp(data(:,1),nicemo2); % Obtain logical index
data(idx,:)
Output:
ans = 2×2 cell array
{'spring'} {[2]}
{'fall' } {[4]}
Tested with MATLAB R2018b.
Also beware variables like sizes as dropping a letter masks a useful function, size.
I have matrices:
a= 0.8147 0.1270 0.6324
0.9058 0.9134 0.0975
b= 0.2785 0.9649 0.9572
0.5469 0.1576 0.4854
0.9575 0.9706 0.8003
c = 0.1419 0.7922
0.4218 0.9595
0.9157 0.6557
and also I have another matrix
I= 1 3 1 1
2 1 3 2
I want to get d matrix such that
d= a(1,3) b(3,1) c(1,1)
a(2,1) b(1,3) c(3,2)
where indices come as two consecutive entries of I matrix.
This is one example I get. However, I get different size matrices for a,b,c,.. and I.
Added: I is m x (n+3) which includes indices, and other (n+2) matrices which have corresponding entries are X,A1,A2,...,An,Y. When n is given, A1,A2,...,An matrices are generated.
Can someone please help me to write Matlab code for this task?
You can do it with varargin. Assuming that your matrices are constructed such that you can form your desired output in the way you want (Updated according to Carmine's answer):
function out = IDcombiner(I, varargin)
out = zeros(size(I, 1), nargin-1);
idx = #(m, I, ii) (sub2ind(size(m), I(:, ii), I(:, ii+1)));
for ii = 1:1:nargin-1
out(:, ii) = varargin{ii}(idx(varargin{ii}, I, ii));
end
Now using this function you can make your selection on a flexible number of inputs:
out = IDcombiner(I, a, b, c)
out =
0.6324 0.9575 0.1419
0.9058 0.9572 0.6557
There is also a one-liner solution, which I do not recommend, since it dramatically decreases the readability of the code and doesn't help you gain much:
IDcombiner = #(I,varargin) ...
cell2mat(arrayfun(#(x) varargin{x}(sub2ind(size(varargin{x}), ...
I(:,x), I(:,x+1))), 1:nargin-1, 'UniformOutput', false));
Normally a matrix is not interpreted as a list of indices, but you can have this if you use sub2ind. To use it you need the size of the matrix you are addressing. Let's make an example starting with a:
a(sub2ind(size(a), I(:,1), I(:,2)))
The code does not change if you first assign the newly generated matrices to a variable name.
will use the column I(:,1) as rows and I(:,2) as columns.
To make the code more readable you can define an anonymous function that does this, let's call it idx:
idx = #(m,I,i)(sub2ind(size(m), I(:,i), I(:,i+1)))
So finally the code will be
d = [a(idx(a,I,1)), b(idx(b,I,2)), c(idx(c,I,3))]
The code does not change if you first assign the newly generated matrices to a variable name.
Other details
Let's make an example with 2 central matrices:
a = rand(3,1) % 3 rows, 1 column
b = rand(3,3) % 3 rows, 3 columns
c = rand(3,3) % another squared matrix
d = rand(3,1) % 3 rows, 1 column
The definition of the anonymous function is the same, you just change the definition of the output vector:
output = [a(idx(a,I,1)), b(idx(b,I,2)), c(idx(c,I,3)), d(idx(d,I,3))]
Keep in mind that following that pattern you always need a I matrix with (n_matrices + 1) columns.
Generalization
Let's generalize this code for a number n of central matrices of size rxr and for "side matrices" of size rxc. I will use some values of those parameters for this example, but you can use what you want.
Let me generate an example to use:
r = 3;
c = 4;
n = 3;
a = rand(r,c); % 2D array
b = rand(r,r,n); % 3D array, along z = 1:n you have 2D matrices of size rxr
c = rand(r,c);
I = [1 3 1 2 1 3; 2 1 3 1 1 1];
The code I wrote can easily be extended using cat to append matrices (note the 2 in the function tells MATLAB to append on the direction of the columns) and a for cycle:
idx = #(m,I,i)(sub2ind(size(m), I(:,i), I(:,i+1)))
d = a(idx(a,I,1));
for i = 1:n
temp = b(:,:,i);
d = cat(2,d,temp(idx(tmp,I,i+1)));
end
d = cat(2,d,c(idx(c,I,n+1)));
If you really don't want to address anything "by hand", you can use cell arrays to put all the matrices together and then cyclically apply the anonymous function to each matrix in the cell array.
I have 64 characters in a 4*4 matrix.I need to convert it into a cell array such that cell has 4 characters.For eg
Consider A=[TCTGCTCTCGGTTATATACACTGCCCAGAACACGTCAACAAGGCCAGTGTATCCTTCTTTGTGT]
i need to get a cell array as below
B={[TCTG][CTCT][CGGT][TATA]
[TACA][CTGC][CCAG][AACA]
[CGTC][AACA][AGGC][CAGT]
[GTAT][CCTT][CTTT][GTGT]}
i tried using the mat2cell function but im not able to understand it.please help.
Using a for-loop:
clc
clear
A = 'TCTGCTCTCGGTTATATACACTGCCCAGAACACGTCAACAAGGCCAGTGTATCCTTCTTTGTGT';
B = cell(4,4);
currentIdx = 0; % Use index to increment by steps of 4 when going through A
for k = 1:16
B{k} = A(currentIdx+1:currentIdx+4);
currentIdx = currentIdx+4;
end
B = B'
B =
'TCTG' 'CTCT' 'CGGT' 'TATA'
'TACA' 'CTGC' 'CCAG' 'AACA'
'CGTC' 'AACA' 'AGGC' 'CAGT'
'GTAT' 'CCTT' 'CTTT' 'GTGT'
You are starting with a 1xN matrix and want to convert it to a 1xN/4 cell array of 1x4 matrices. Your command should then be:
N = length(A);
M = 4;
B = mat2cell(A,1,ones(1,N/M)*M);
The first dimension is the 1, the second dimension is a string of 4's the size of the output cell array. The result:
B =
Columns 1 through 12
'TCTG' 'CTCT' 'CGGT' 'TATA' 'TACA' 'CTGC' 'CCAG' 'AACA' 'CGTC' 'AACA' 'AGGC' 'CAGT'
Columns 13 through 16
'GTAT' 'CCTT' 'CTTT' 'GTGT'
You can use method vec2mat that breaks your input vector to matrix
M = vec2mat(A, numberOfColumns)
(In your case numberOfColumns would be 16) and then use mat2cell. In your case, it would be:
C = mat2cell(M, [1,1,1,1], [4,4,4,4])
It means that all cels will have one row and 4 columns).
Effect of function c = mat2cell(x, [10, 20, 30], [25, 25]) would be:
The image shows why you have to convert vector to matrix. (example from matlab documentation)
You can also (ab)use the very versatile accumarray for this task:
A = 'TCTGCTCTCGGTTATATACACTGCCCAGAACACGTCAACAAGGCCAGTGTATCCTTCTTTGTGT';
n = 4;
B = accumarray(ceil(1/n:1/n:numel(A)/n).', A(:), [], #(x) {x.'}).'
How can I reshape a 2d array to a 3d array with the last column being used as pages?
All data found in array2d should be in pages
example:
array2d=[7,.5,12; ...
1,1,1; ...
1,1,1; ...
4,2,4; ...
2,2,2; ...
2,2,2; ...
3,3,3; ...
3,3,3; ...
3,3,3];
The first page in the array would be
7,.5,12;
1,1,1;
1,1,1;
The second page in the array would be
4,2,4;
2,2,2;
2,2,2;
The third page in the array would be
3,3,3;
3,3,3;
3,3,3;
This is a 9x3 array how can I get it to be a 9x3x? (not sure what this number should be so I placed a question mark as a place holder) multidimensional array?
What I'm trying to get is to have
All the ones would be on one dimension/page all the two's would be another dimension/page etc... –
I tried reshape(array2d,[9,3,1]) and it's still a 9x3
Use permute with reshape -
N = 3; %// Cut after every N rows to form a "new page"
array3d = permute(reshape(array2d,N,size(array2d,1)/N,[]),[1 3 2]) %// output
Assuming that each slice of your matrix is the same in dimensions, we can do this very easily. Let's call the number of rows and columns that each slice would have to be M and N respectively. In your example, this would be M = 3 and N = 3. As such, assuming array2d is of the above form, we can do the following:
M = 3;
N = 3; %// This is also simply the total number of columns we have,
%// so you can do size(array2d, 2);
outMatrix = []; %// Make this empty. We will populate as we go.
%// Figure out how many slices we need
numRows = size(array2d,1) / M;
for k = 1 : numRows
%// Extract the k'th slice
%// Reshape so that it has the proper dimensions
%// of one slice
sliceK = reshape(array2d(array2d == k), M, N);
%// Concatenate in the third dimension
outMatrix = cat(3,outMatrix,sliceK);
end
With your example, we thus get:
>> outMatrix
outMatrix(:,:,1) =
1 1 1
1 1 1
1 1 1
outMatrix(:,:,2) =
2 2 2
2 2 2
2 2 2
outMatrix(:,:,3) =
3 3 3
3 3 3
3 3 3
This method should generalize for any number of rows and columns for each slice, provided that each slice shares the same dimensions.
Your array is already of size 1 in the 3rd dimension (in other words, it is already 9x3x1, to prove this try entering array2d(1,1,1)). If you want to concatenate 2d matrices along the 3rd dimension you can use cat.
For example:
a = [1,2;3,4];
b = [5,6;7,8];
c = cat(3,a,b);
c will be a 2x2x2 matrix.
This piece of code is specific for this example, I hope you will be able to understand how to go for other data samples.
out2 = [];
col = size(array2d,2);
for i = 1:3
temp2 = reshape(array2d(array2d == i),[],col);
out2 = cat(3,out2,temp2);
end