Array saving entire input file to one index? C - c

Question

this might look familiar, but am having different problems come up, so I'm trying to ask a different question. My assignment is to read in a file like so:
AACTGGTGCAGATACTGTTGA
3
AACTGGTGCAGATACTGCAGA
CAGTTTAGAG
CATCATCATCATCATCATCAT
The first line is the original line I will testing the following ones against, with the second line giving the number of remaining lines. When I run the following code, it prints out my entire input file, but to the first index. So while I need each line to be a separate index to be able to call them, it isn't working out.
I assume I'm going wrong by having the defined LENGTH and ROW so big, but am unsure of any other way to save it line by line, especially since it is mixed (chars with a line of int in between). My problem here is also that I have no prior knowledge given of how long either the rows of "DNA" will be nor how many lines total.
For what it's worth: I was advised a few things but am still unsure how to literally implement them.
One of these was to first use fscanf with %s for the first line, then fscanf with %d for the second, and a loop of fscanf %s for the remaining lines. I've tried doing that, but couldn't get that to work properly either.
The second way I was given was "fgets() for the first line, fscanf() + fgetc() for the second line, and then a loop of fgets() for everything that remains." Again, I am unsure of how to implement this exactly.
Please and thank you!
Here's my code so far:
#include <stdlib.h>
#include <stdio.h>
#include <string.h>
#define LENGTH 125
#define ROW 125
struct dna{
char code [LENGTH];
};
int main(){
char filename[] = "input1.txt";
FILE *input = fopen("input1.txt","r");
char firstDna[LENGTH][ROW]={""};
int n=0,i=0,j;
makeArray(input,firstDna);
//closing file
fclose(input);
system("pause");
return 0;
}
void makeArray(FILE *input,char firstDna[LENGTH][ROW]){
int i,j;
for(i = 0; i < LENGTH; i++){
for(j =0; j < ROW; j++){
fscanf(input,"%c",&firstDna[i][j]);
printf("%c", firstDna[i][j]);
i++;
}
}printf("\n\n\n");
}

Answer 1

I implemented the first "advise" that you mentioned, fscanf with %s for the first line and fscnanf with %d for the second ...
#include <stdlib.h>
#include <stdio.h>
#include <string.h>
#define LENGTH 125
#define ROW 125
struct dna{
char code [LENGTH];
};
void makeArray(FILE *input,char firstDna[LENGTH][ROW])
{
int i;
int remaining_lines;
fscanf(input,"%s\n",firstDna[0]);
printf("%s\n", firstDna[0]);
//scanning the number of remaing_lines
fscanf(input,"%d\n",&remaining_lines);
for(i = 1; i < LENGTH && i <= remaining_lines; i++)
{
fscanf(input,"%s\n",firstDna[i]);
printf("%s\n", firstDna[i]);
}
}
int main(){
char filename[] = "input1.txt";
FILE *input = fopen(filename,"r");
char firstDna[LENGTH][ROW];
makeArray(input,firstDna);
//closing file
fclose(input);
system("pause");
return 0;
}
hope this helps