PYTHON- Print Certain Number of Lines in File? - file

I want my program to read a number of lines determined by the user, but I only know how to make it print a certain number of bytes (stored in fLine). Can someone help me out? Thank you!!
fName = raw_input("hello what file would you like to open?: ")
fLine = int(raw_input("how many lines would you like to print?: "))
try:
inFile = open(fName, 'r')
except:
print "failed to open %s sry" % fName
else:
line = inFile.read(fLine)
print line
inFile.close()


You want to use Python? If yes, try to use readlines() function .

Related

Is there a way to make python print to file for every iteration of a for loop instead of storing all in the buffer?

I am looping over a very large document to try and lemmatise it.
Unfortunately python does not seem to print to file for every line but run through the whole document before printing, which given the size of my file exceeds the memory...
Before I chunk my document into more bite-sized chunks I wondered if there was a way to force python to print to file for every line.
So far my code reads:
import spacy
nlp = spacy.load('de_core_news_lg')
fin = "input.txt"
fout = "output.txt"
#%%
with open(fin) as f:
corpus = f.readlines()
corpus_lemma = []
for word in corpus:
result = ' '.join([token.lemma_ for token in nlp(word)])
corpus_lemma.append(result)
with open(fout, 'w') as g:
for item in corpus_lemma:
g.write(f'{item}')
To give credits for the code, it was kindly suggested here: Ho to do lemmatization on German text?

As described in: How to read a large file - line by line?
If you do your lemmatisation inside the with block, Python will handle reading line by line using buffered I/O.
In your case, it would look like:
import spacy
nlp = spacy.load('de_core_news_lg')
fin = "input.txt"
fout = "output.txt"
#%%
corpus_lemma = []
with open(fin) as f:
for line in f:
result = " ".join(token.lemma_ for token in nlp(line))
corpus_lemma.append(result)
with open(fout) as g:
for item in corpus_lemma:
g.write(f"{item}")

How to completely remove a line from a file?

How do I completely remove a line in Rust? Not just replace it with an empty line.
In Rust, when you delete a line from a file with the following code as an example:
let mut file: File = File::open("file.txt").unwrap();
let mut buf = String::from("");
file.read_to_string(&mut buf).unwrap(); //Read the file to a buffer
let reader = BufReader::new(&file);
for (index, line) in reader.lines().enumerate() { //Loop through all the lines in the file
if line.as_ref().unwrap().contains("some text") { //If the line contains "some text", execute the block
buf = buf.replace(line.as_ref().unwrap(), ""); //Replace "some text" with nothing
}
}
file.write_all(buf.as_bytes()).unwrap(); //Write the buffer back to the file
file.txt:
random text
random text
random text
some text
random text
random text
When you run the code, file.txt turns into this:
random text
random text
random text
random text
random text
Rather than just
random text
random text
random text
random text
random text
Is there any way to completely remove the line rather than just leaving it blank? Like some sort of special character?

This part is bad-news: buf = buf.replace(line.as_ref().unwrap(), "");
This is doing a search through your entire buffer to find the line contents (without '\n') and replace it with "". To make it behave as you expect you need to add back in the newline. You can just about do this by buf.replace(line.as_ref().unwrap() + "\n", "") The problem is that lines() treats more than "\n" as a newline, it also splits on "\r\n". If you know you're always using "\n" or "\r\n" as newlines you can work around this - if not you'll need something tricker than lines().
However, there is a trickier issue. For larger files, this may end up scanning through the string and resizing it many times, giving an O(N^2) style behaviour rather than the expected O(N). Also, the entire file needs to be read into memory, which can be bad for very large files.
The simplest solution to the O(N^2) and memory issues is to do your processing line-by-line, and
then move your new file into place. It would look something like this.
//Scope to ensure that the files are closed
{
let mut file: File = File::open("file.txt").unwrap();
let mut out_file: File = File::open("file.txt.temp").unwrap();
let reader = BufReader::new(&file);
let writer = BufWriter::new(&out_file);
for (index, line) in reader.lines().enumerate() {
let line = line.as_ref().unwrap();
if !line.contains("some text") {
writeln!(writer, "{}", line);
}
}
}
fs::rename("file.txt.temp", "file.txt").unwrap();
This still does not handle cross-platform newlines correctly, for that you'd need a smarter lines iterator.

Hmm could try removing the new line char in the previous line

Try and except exit error after executing the except line

I am trying to exit out of the program after executing the except line. I have tried sys.exit(1) but it is not working. I am opening an .txt file and and passing it through the code. The code works perfectly. I am just trying to exit out of the code if the wrong file is input like temp file rather then temp.txt.
# Ask input from the user
fname = input("Enter File Name: ")
# Open the file and check if entry is valid
try:
temp_file = open(fname)
except:
print("File cannot be opened:", fname)
# I NEED YOUR HELP HERE
quit()
count = 0
total = 0
for temp in temp_file:
# Remove white space
temp = temp.strip()
# Find the exact string
if temp.startswith("X-DSPAM-Confidence:"):
# Find the position of the number and convert to float
pos = temp.find(":")
float_pos = float(temp[pos+1:])
# Add the numbers and count the number of lines
total += float_pos
count += 1
# Print out the average
print("Average spam confidence: ", total/count)

How to modify a file php

I am trying to modify a text file I am using PHP or also I can use the C# the file that I am working on a text file consists of strings for example
TM_len= --------------------------------------------
EMM_len --------------------------------------------
T_len=45 CTGCCTGAGCTCGTCCCCTGGATGTCCGGGTCTCCCCAGGCGG
NM_=2493 ----------------ATATAAAAAGATCTGTCTGGGGCCGAA
and I want to delete those four lines from the file if I found that one line consists of only "-" no characters in it and of course save to the file.

Maybe something like this? I wrote it in a easy to understand and "not-shortened" way:
$newfiledata = "";
$signature = " ";
$handle = fopen("inputfile.txt", "r"); // open file
if ($handle) {
while (($line = fgets($handle)) !== false) { // read line by line
$pos = strpos($line, $signature); // locate spaces in line text
if ($pos) {
$lastpart = trim(substr($line, $pos)); // get second part of text
$newstring = trim(str_replace('-', '', $line)); // remove all dashes
if (len($newstring) > 0) $newfiledata .= $line."\r\n"; // if still there is characters, append it to our variable
}
}
fclose($handle);
}
// write new file
file_put_contents("newfile.txt", $newfiledata);

thanks for your response but there nothing happened on the file please check the link of the file and another link of the desired output for the file.download the file and required output file

Save a string vector as csv in matlab

I have the following string array in matlab built the following way:
labels=textread(nome_tecnicas_base, '%s');
for i=1:size(labels)
temp_vector=cell(1,10);
[temp_vector{1:10}]=deal(labels{i});
final_vector=horzcat(final_vector,temp_vector);
end
I want to save this vector with each string value separated with commas (e.g., csv files) in a text file. I tried in several ways, but when I try to read it with, for example, the textread function i have the following error:
a=textread('labels-cpen-R.txt')
Error using dataread
Trouble reading number from file (row 1, field 1) ==> dct,dct,dct,dct,dct,dct,dct,dct,dct,dct,hierar
this is how my file was saved
dct,dct,dct,dct,dct,dct,dct,dct,dct,dct,hierarch-sift,hierarch-sift,hierarch-sift,hierarch-sift,hierarch-sift,hierarch-sift,hierarch-sift,hierarch sift,hierarch-sift,hierarch
sift,zernike,zernike,zernike,zernike,zernike,zernike,zernike,zernike,zernike,zernike,zernike2,zernike2,zernike2,zernike2,zernike2,zernike2,zernike2,zernike2,zernike2,zernike2,kpca,kpca,kpca,kpca,kpca,kpca,kpca,kpca,kpca,kpca,sift,sift,sift,sift,sift,sift,sift,sift,sift,sift,surf,surf,surf,surf,surf,surf,surf,surf,surf,surf,bayesianfusion0,bayesianfusion0,bayesianfusion0,bayesianfusion0,bayesianfusion0,bayesianfusion0,bayesianfusion0,bayesianfusion0,bayesianfusion0,bayesianfusion0,bks-fusion,bks-fusion,bks-fusion,bks-fusion,bks-fusion,bks-fusion,bks-fusion,bks-fusion,bks-fusion,bks-fusion,fusionvoting4,fusionvoting4,fusionvoting4,fusionvoting4,fusionvoting4,fusionvoting4,fusionvoting4,fusionvoting4,fusionvoting4,fusionvoting4,fusionvoting6,fusionvoting6,fusionvoting6,fusionvoting6,fusionvoting6,fusionvoting6,fusionvoting6,fusionvoting6,fusionvoting6,fusionvoting6,multiscale_voting,multiscale_voting,multiscale_voting,multiscale_voting,multiscale_voting,multiscale_voting,multiscale_voting,multiscale_voting,multiscale_voting,multiscale_voting,bks_rf_lvt,bks_rf_lvt,bks_rf_lvt,bks_rf_lvt,bks_rf_lvt,bks_rf_lvt,bks_rf_lvt,bks_rf_lvt,bks_rf_lvt,bks_rf_lvt,bks_svr_lvt,bks_svr_lvt,bks_svr_lvt,bks_svr_lvt,bks_svr_lvt,bks_svr_lvt,bks_svr_lvt,bks_svr_lvt,bks_svr_lvt,bks_svr_lvt,bks_svr_otsu,bks_svr_otsu,bks_svr_otsu,bks_svr_otsu,bks_svr_otsu,bks_svr_otsu,bks_svr_otsu,bks_svr_otsu,bks_svr_otsu,bks_svr_otsu,multiscale_bks_rf_lvt,multiscale_bks_rf_lvt,multiscale_bks_rf_lvt,multiscale_bks_rf_lvt,multiscale_bks_rf_lvt,multiscale_bks_rf_lvt,multiscale_bks_rf_lvt,multiscale_bks_rf_lvt,multiscale_bks_rf_lvt,multiscale_bks_rf_lvt,multiscale_bks_svr_lvt,multiscale_bks_svr_lvt,multiscale_bks_svr_lvt,multiscale_bks_svr_lvt,multiscale_bks_svr_lvt,multiscale_bks_svr_lvt,multiscale_bks_svr_lvt,multiscale_bks_svr_lvt,multiscale_bks_svr_lvt,multiscale_bks_svr_lvt
How can I save this vector and how can I read this file properly?

try textscan for reading and fprintf for writing
from the matlab documentation:
fileID = fopen('data.csv');
C = textscan(fileID,'%f %f %f %f %u8 %f',...
'Delimiter',',','EmptyValue',-Inf);
so in your case:
textscan(fileID,'%s', 'Delimiter', ',')
edit: for writing data to a file, you can use fprintf with a file identifier:
fileID= fopen('data.csv', 'w') ;
fprintf(fileID, '%s,', data{1,1:end-1}) ;
fprintf(fileID, '%s\n', data{1,end}) ;
fclose(fileID)

Resources