A similar question has been asked, but still I'm looking for a solution.
In MATLAB, I have an array of states s:
s = {'Indiana', 'Texas', 'Alabama'}
Time is a column vector: [120 30 20 40 50]'
Tornadoes is a column vector: [5 5 3 5 5]'
And I need to for loop through this array s for the following code below while placing each string in s in the first line.
index = strcmpi(States,s)
Time = Time(index)
Tornadoes = Tornadoes(index)
h = scatter(Time,Tornadoes)
So how can I write the code to push each state in s to generate a plot for each plot.
Could it be as simple as this?
for ii = 1:numel(s)
index = strcmpi(States, s{ii})
Time = Time(index)
Tornadoes = Tornadoes(index)
figure % make sure you start a new figure each time...
h = scatter(Time,Tornadoes)
title(['Tornadoes in ' s{ii}])
end
If you are wanting to loop through each entry in s, you could do
j = length(s)
for i = 1:j
x = Time(i)
y = Tornadoes(i)
h = scatter(x, y)
end
Related
I have an application with an array of matrices. I have to manipulate the diagonals several times. The other elements are unchanged. I want to do things like:
for j=1:nj
for i=1:n
g(i,i,j) = gd(i,j)
end
end
I have seen how to do this with a single matrix using logical(eye(n)) as a single index, but this does not work with an array of matrices. Surely there is a way around this problem. Thanks
Use a linear index as follows:
g = rand(3,3,2); % example data
gd = [1 4; 2 5; 3 6]; % example data. Each column will go to a diagonal
s = size(g); % size of g
ind = bsxfun(#plus, 1:s(1)+1:s(1)*s(2), (0:s(3)-1).'*s(1)*s(2)); % linear index
g(ind) = gd.'; % write values
Result:
>> g
g(:,:,1) =
1.000000000000000 0.483437118939645 0.814179952862505
0.154841697368116 2.000000000000000 0.989922194103104
0.195709075365218 0.356349047562417 3.000000000000000
g(:,:,2) =
4.000000000000000 0.585604389346560 0.279862618046844
0.802492555607293 5.000000000000000 0.610960767605581
0.272602365429990 0.551583664885735 6.000000000000000
Based on Luis Mendo's answer, a version that may perhaps be more easy to modify depending on one's specific purposes. No doubt his version will be more computationally efficient though.
g = rand(3,3,2); % example data
gd = [1 4; 2 5; 3 6]; % example data. Each column will go to a diagonal
sz = size(g); % Get size of data
sub = find(eye(sz(1))); % Find indices for 2d matrix
% Add number depending on location in third dimension.
sub = repmat(sub,sz(3),1); %
dim3 = repmat(0:sz(1)^2:prod(sz)-1, sz(1),1);
idx = sub + dim3(:);
% Replace elements.
g(idx) = gd;
Are we already playing code golf yet? Another slightly smaller and more readable solution
g = rand(3,3,2);
gd = [1 4; 2 5; 3 6];
s = size(g);
g(find(repmat(eye(s(1)),1,1,s(3))))=gd(:)
g =
ans(:,:,1) =
1.00000 0.35565 0.69742
0.85690 2.00000 0.71275
0.87536 0.13130 3.00000
ans(:,:,2) =
4.00000 0.63031 0.32666
0.33063 5.00000 0.28597
0.80829 0.52401 6.00000
I have a question regarding indexing and loops in MATLAB. I have a vector of length n (named data in the code below). I want to examine this vector 4 elements at a time inside of a for loop. How can I do this? My attempt included below does not work because it will exceed the array dimensions at the end of the loop.
for k = 1:length(data)
index = k:k+3;
cur_data = data(index);
pre_q_data1 = cur_data(1);
pre_q_data2 = cur_data(2);
% Interweaving the data
q = [pre_q_data1; pre_q_data2];
qdata = q(:)';
pre_i_data1 = cur_data(3);
pre_i_data2 = cur_data(4);
i = [pre_i_data1; pre_i_data2];
idata = i(:)';
end
You shouldn't have k go all the way to length(data) if you're planning on indexing up to k+3.
I've also taken the liberty of greatly simplifying your code, but feel free to ignore that!
for k = 1:length(data)-3
% maximum k = length(data)-3, so maximum index = length(data)-3+3=length(data)
index = k:k+3;
cur_data = data(k:k+3);
% Interweaving the data
q = cur_data(1:2); % transpose at end of line here if need be
i = cur_data(3:4); % could just use data(k+2:k+3) and not use cur_data
end
Suppose I have two arrays ordered in an ascending order, i.e.:
A = [1 5 7], B = [1 2 3 6 9 10]
I would like to create from B a new vector B', which contains only the closest values to A values (one for each).
I also need the indexes. So, in my example I would like to get:
B' = [1 6 9], Idx = [1 4 5]
Note that the third value is 9. Indeed 6 is closer to 7 but it is already 'taken' since it is close to 4.
Any idea for a suitable code?
Note: my true arrays are much larger and contain real (not int) values
Also, it is given that B is longer then A
Thanks!
Assuming you want to minimize the overall discrepancies between elements of A and matched elements in B, the problem can be written as an assignment problem of assigning to every row (element of A) a column (element of B) given a cost matrix C. The Hungarian (or Munkres') algorithm solves the assignment problem.
I assume that you want to minimize cumulative squared distance between A and matched elements in B, and use the function [assignment,cost] = munkres(costMat) by Yi Cao from https://www.mathworks.com/matlabcentral/fileexchange/20652-hungarian-algorithm-for-linear-assignment-problems--v2-3-:
A = [1 5 7];
B = [1 2 3 6 9 10];
[Bprime,matches] = matching(A,B)
function [Bprime,matches] = matching(A,B)
C = (repmat(A',1,length(B)) - repmat(B,length(A),1)).^2;
[matches,~] = munkres(C);
Bprime = B(matches);
end
Assuming instead you want to find matches recursively, as suggested by your question, you could either walk through A, for each element in A find the closest remaining element in B and discard it (sortedmatching below); or you could iteratively form and discard the distance-minimizing match between remaining elements in A and B until all elements in A are matched (greedymatching):
A = [1 5 7];
B = [1 2 3 6 9 10];
[~,~,Bprime,matches] = sortedmatching(A,B,[],[])
[~,~,Bprime,matches] = greedymatching(A,B,[],[])
function [A,B,Bprime,matches] = sortedmatching(A,B,Bprime,matches)
[~,ix] = min((A(1) - B).^2);
matches = [matches ix];
Bprime = [Bprime B(ix)];
A = A(2:end);
B(ix) = Inf;
if(not(isempty(A)))
[A,B,Bprime,matches] = sortedmatching(A,B,Bprime,matches);
end
end
function [A,B,Bprime,matches] = greedymatching(A,B,Bprime,matches)
C = (repmat(A',1,length(B)) - repmat(B,length(A),1)).^2;
[minrows,ixrows] = min(C);
[~,ixcol] = min(minrows);
ixrow = ixrows(ixcol);
matches(ixrow) = ixcol;
Bprime(ixrow) = B(ixcol);
A(ixrow) = -Inf;
B(ixcol) = Inf;
if(max(A) > -Inf)
[A,B,Bprime,matches] = greedymatching(A,B,Bprime,matches);
end
end
While producing the same results in your example, all three methods potentially give different answers on the same data.
Normally I would run screaming from for and while loops in Matlab, but in this case I cannot see how the solution could be vectorized. At least it is O(N) (or near enough, depending on how many equally-close matches to each A(i) there are in B). It would be pretty simple to code the following in C and compile it into a mex file, to make it run at optimal speed, but here's a pure-Matlab solution:
function [out, ind] = greedy_nearest(A, B)
if nargin < 1, A = [1 5 7]; end
if nargin < 2, B = [1 2 3 6 9 10]; end
ind = A * 0;
walk = 1;
for i = 1:numel(A)
match = 0;
lastDelta = inf;
while walk < numel(B)
delta = abs(B(walk) - A(i));
if delta < lastDelta, match = walk; end
if delta > lastDelta, break, end
lastDelta = delta;
walk = walk + 1;
end
ind(i) = match;
walk = match + 1;
end
out = B(ind);
You could first get the absolute distance from each value in A to each value in B, sort them and then get the first unique value to a sequence when looking down in each column.
% Get distance from each value in A to each value in B
[~, minIdx] = sort(abs(bsxfun(#minus, A,B.')));
% Get first unique sequence looking down each column
idx = zeros(size(A));
for iCol = 1:numel(A)
for iRow = 1:iCol
if ~ismember(idx, minIdx(iRow,iCol))
idx(iCol) = minIdx(iRow,iCol);
break
end
end
end
The result when applying idx to B
>> idx
1 4 5
>> B(idx)
1 6 9
I have 2 cell arrays which are "celldata" and "data" . Both of them store strings inside. Now I would like to check each element in "celldata" whether in "data" or not? For example, celldata = {'AB'; 'BE'; 'BC'} and data={'ABCD' 'BCDE' 'ACBE' 'ADEBC '}. I would like the expected output will be s=3 and v= 1 for AB, s=2 and v=2 for BE, s=2 and v=2 for BC, because I just need to count the sequence of the string in 'celldata'
The code I wrote is shown below. Any help would be certainly appreciated.
My code:
s=0; support counter
v=0; violate counter
SV=[]; % array to store the support
VV=[]; % array to store the violate
pairs = ['AB'; 'BE'; 'BC']
%celldata = cellstr(pairs)
celldata = {'AB'; 'BE'; 'BC'}
data={'ABCD' 'BCDE' 'ACBE' 'ADEBC '} % 3 AB, 2 BE, 2 BC
for jj=1:length(data)
for kk=1:length(celldata)
res = regexp( data(jj),celldata(kk) )
m = cell2mat(res);
e=isempty(m) % check res array is empty or not
if e == 0
s = s + 1;
SV(jj)=s;
v=v;
else
s=s;
v= v+1;
VV(jj)=v;
end
end
end
If I am understanding your variables correctly, s is the number of cells which the substring AB, AE and, BC does not appear and v is the number of times it does. If this is accurate then
v = cellfun(#(x) length(cell2mat(strfind(data, x))), celldata);
s = numel(data) - v;
gives
v = [1;1;3];
s = [3;3;1];
I have 64 characters in a 4*4 matrix.I need to convert it into a cell array such that cell has 4 characters.For eg
Consider A=[TCTGCTCTCGGTTATATACACTGCCCAGAACACGTCAACAAGGCCAGTGTATCCTTCTTTGTGT]
i need to get a cell array as below
B={[TCTG][CTCT][CGGT][TATA]
[TACA][CTGC][CCAG][AACA]
[CGTC][AACA][AGGC][CAGT]
[GTAT][CCTT][CTTT][GTGT]}
i tried using the mat2cell function but im not able to understand it.please help.
Using a for-loop:
clc
clear
A = 'TCTGCTCTCGGTTATATACACTGCCCAGAACACGTCAACAAGGCCAGTGTATCCTTCTTTGTGT';
B = cell(4,4);
currentIdx = 0; % Use index to increment by steps of 4 when going through A
for k = 1:16
B{k} = A(currentIdx+1:currentIdx+4);
currentIdx = currentIdx+4;
end
B = B'
B =
'TCTG' 'CTCT' 'CGGT' 'TATA'
'TACA' 'CTGC' 'CCAG' 'AACA'
'CGTC' 'AACA' 'AGGC' 'CAGT'
'GTAT' 'CCTT' 'CTTT' 'GTGT'
You are starting with a 1xN matrix and want to convert it to a 1xN/4 cell array of 1x4 matrices. Your command should then be:
N = length(A);
M = 4;
B = mat2cell(A,1,ones(1,N/M)*M);
The first dimension is the 1, the second dimension is a string of 4's the size of the output cell array. The result:
B =
Columns 1 through 12
'TCTG' 'CTCT' 'CGGT' 'TATA' 'TACA' 'CTGC' 'CCAG' 'AACA' 'CGTC' 'AACA' 'AGGC' 'CAGT'
Columns 13 through 16
'GTAT' 'CCTT' 'CTTT' 'GTGT'
You can use method vec2mat that breaks your input vector to matrix
M = vec2mat(A, numberOfColumns)
(In your case numberOfColumns would be 16) and then use mat2cell. In your case, it would be:
C = mat2cell(M, [1,1,1,1], [4,4,4,4])
It means that all cels will have one row and 4 columns).
Effect of function c = mat2cell(x, [10, 20, 30], [25, 25]) would be:
The image shows why you have to convert vector to matrix. (example from matlab documentation)
You can also (ab)use the very versatile accumarray for this task:
A = 'TCTGCTCTCGGTTATATACACTGCCCAGAACACGTCAACAAGGCCAGTGTATCCTTCTTTGTGT';
n = 4;
B = accumarray(ceil(1/n:1/n:numel(A)/n).', A(:), [], #(x) {x.'}).'