Reading in char from file into struct - c

Question

For my assignment, I have to read in a text file with a varying amount of lines. They follow the following format:
AACTGGTGCAGATACTGTTGA
3
AACTGGTGCAGATACTGCAGA
CAGTTTAGAG
CATCATCATCATCATCATCAT
The first line is the original line I will testing the following ones against, with the second line giving the number of remaining lines.
I'm having trouble trying to save these to a struct, and can't even get the first line to save. I tried using the void function with an array and it seems to work, but can't seem to transfer it over to structs.
Here's my code so far:
#include <stdlib.h>
#include <stdio.h>
#include <string.h>
#define LENGTH 25
struct dna {
char code[LENGTH];
};
int main(){
char filename[] = "input1.txt";
FILE *input = fopen("input1.txt","r");
char firstDna[LENGTH]="";
struct dna first;
struct dna first.code[]= "";
makeArray(input,first);
// printf("%s",filename);
system("pause");
return 0;
}
void makeArray(FILE *input,struct dna first){
int i=-1;
//nested for loops to initialze array
//from file
while(i != '\n'){
fscanf(input,"%c",first[i].code);
printf("%c", first[i].code);
i++;
}//closing file
fclose(input);
}

Answer 1

Since this is for a class assignment, I want to preface this by saying that a good way to tackle these types of assignments is to break it up into tasks, then implement them one by one and finally connect them. In this case the tasks might be something like:
parse the first line into a (struct containing a) char array.
parse the number into an int variable
parse each remaining line in the file like you did with the first line
test the first line against the other lines in the file (except the number)
You also mentioned in a comment that the struct is for extra credit. For that reason, I'd recommend implementing it using just a char array first, then refactoring it into a struct once you have the basic version working. That way you have something to fall back on just in case. This way of developing might seem unnecessary at this point, but for larger more complicated projects it becomes a lot more important, so it's a really good habit to get into as early as possible.
Now, let's look at the code. I'm not going to give you the program here, but I'm going to identify the issues I see in it.
Let's start with the main method:
char filename[] = "input1.txt";
FILE *input = fopen("input1.txt","r");
This opens the file you're reading from. You're opening it correctly, but the first line is in this case unnecessary, since you never actually use the filename variable anywhere.
You also correctly close the file at the end of the makeArray function with the line:
fclose(input);
Which works. It would, however, probably be better style if you put this in the main method after calling the makeArray function. It's always a good idea to open and close files in the same function if possible, since this means you will always know you didn't forget to close the file without having to look through your entire program. Again, not really an issue in a small project, but a good habit to get into. Another solution would be to put the fopen and fclose functions in the makeArray function, so main doesn't have to know about them, then just send the char array containing the filepath to makeArray instead of the FILE*.
The next issue I see is with how you are passing the parameters to the makeArray function. To start off, instead of having a separate function, try putting everything in the main method. Using functions is good practice, but do this just to get something working.
Once that's done, something you need to be aware of is that if you're passing or returning arrays or pointers to/from functions, you will need to look up the malloc and free functions, which you may not have covered yet. This can be one of the more complex parts of C, so you might want to save this for last.
Some other things. I won't go into detail about these but try to get the concepts and not just copy paste:
struct dna first.code[]= ""; should probably be first.code[0] = \0;. \0 is used in C to terminate strings, so this will make the string empty.
Passing %c to fscanf reads a single character (you can also use fgetc for this). In this case, it will probably be easier using %s, which will return a word as a string.
Assuming you do use %s, which you probably should, you will need to call it twice before the loop - once to get the first DNA sequence and another time to get the number of other DNA sequences (the number of iterations).
Each iteration of the loop will then test the original DNA sequence against the next DNA sequence in the file.
I hope that helps!

Answer 2

sample to fix
#include <stdlib.h>
#include <stdio.h>
#include <string.h>
#define LENGTH 25
struct dna {
char code[LENGTH];
};
struct dna *makeArray(FILE *input, int *n);//n : output, number of elements
int main(void){
char filename[] = "input1.txt";
FILE *input = fopen(filename,"r");
struct dna first = { "" };
fscanf(input, "%24s", first.code);//read first line
printf("1st : %s\n", first.code);
int i, size;
struct dna *data = makeArray(input, &size);//this does close file
for(i = 0; i < size; ++i){
printf("%3d : %s\n", i+1, data[i].code);
}
free(data);//release data
system("pause");
return 0;
}
struct dna *makeArray(FILE *input, int *n){//n : output, number of elements
int i;
fscanf(input, "%d", n);//read "number of remaining lines"
struct dna *arr = calloc(*n, sizeof(struct dna));//like as struct dna arr[n] = {{0}};
for(i = 0; i < *n; ++i){
fscanf(input, "%24s", arr[i].code);
}
fclose(input);
return arr;
}

Answer 3

a simple fix might be :
#include <stdlib.h>
#include <stdio.h>
#include <string.h>
#define LENGTH 25
struct dna {
char code[LENGTH];
};
void makeArray(FILE *input,struct dna *first){
int i=0;
fscanf(input,"%c",&first->code[i]);
printf("%c",first->code[i]);
while(first->code[i] != '\n' && i < LENGTH){
i++;
fscanf(input,"%c",&first->code[i]);
printf("%c",first->code[i]);
}
}
int main() {
struct dna first;
char filename[] = "input1.txt";
FILE *input = fopen(filename,"r");
makeArray(input,&first);
fclose(input);
printf("%s",first.code);
return 0;
}
PS: i tried to not change your original code
in order to change the code[Length] in the makeArray function you will have to pass it's adresse this is why i call mkaeArray function this way : makeArray(input,&first);.