In my program I am getting a seg fault and I'm not sure the cause or how to find out the cause. Any help would be greatly appreciated!
In the code I am trying to read word by word, but I need to keep track of the line numbers. Then I am trying to create a linked list where the data is the word and line number.
(there are two files compiled together)
void main(int argc, char **argv){
file = fopen(argv[1],"r");
struct fileIndex *fIndex = NULL;
delimiters = " .,;:!-";/*strtok chars to seperate*/
int wCount = wordcount(file);/*number of words in file*/
char **str[wCount+1];/*where the lines are being stored*/
int j=0;
while(!feof(file)){/*inserting lines*/
fscanf(file, "%s", &str[j]);
j++;
}
char *token, *cp;
int i;
int len;
for(i = 0; str[i]; i++){/*checking to insert words*/
len = strlen(*str[i]);
cp = xerox(*str[i]);
token = strtok(cp, delimiters);
if(!present(fIndex, token)){
insert(fIndex, i+1,token);
}
while(token!=NULL){
token = strtok(NULL, delimiters);
if(!present(fIndex, token)){
insert(fIndex, i+1,token);
}
}
i++;
}
fclose(file);
}
int strcmpigncase(char *s1, char *s2){/*checks words*/
for(;*s1==*s2;s1++,s2++){
if(*s1=='\0')
return 0;
}
return tolower(*s2)-tolower(*s2);
}
present(struct fileIndex* fIndex, char *findIt){/*finds if word is in structure*/
struct fileIndex* current = fIndex;
while(current!=NULL){
current = current -> next;
if(strcmpigncase(current -> str, findIt)==0){
return current -> lineNum;
}
}
return 0;
}
void insert(struct fileIndex *head, int num, char *insert){/*inserts word into structure*/
struct fileIndex* node = malloc(sizeof(struct fileIndex));
node -> str = insert;
node -> lineNum = num;
node -> next = head;
head = node;
}
#define IN_WORD 1
#define OUT_WORD 0
int wordcount(FILE *input)/*number of words in file*/
{
FILE *open = input;
int cur; /* current character */
int lc=0; /* line count */
int state=OUT_WORD;
while ((cur=fgetc(open))!=EOF) {
if (cur=='\n')
lc++;
if (!isspace(cur) && state == OUT_WORD) {
state=IN_WORD;
}
else if (state==IN_WORD && isspace(cur)) {
state=OUT_WORD;
}
}
return lc;
}
char *xerox(char *s){
int i = strlen(s);
char *buffer = (char *)(malloc(i+1));
if(buffer == NULL)
return NULL;
char *t = buffer;
while(*s!='\0'){
*t=*s;
s++; t++;
}
*t = '\0';
return buffer;
}
This code has a fairly high rate of problems. I'll dissect just the first few lines to give an idea:
void main(int argc, char **argv){
main should return int, not void. Probably not causing your problem, but not right either.
file = fopen(argv[1],"r");
You really need to check the value of argc before trying to use argv[1]. Invoking the program without an argument may well lead to a problem. Depending on how you've invoked it, this could be the cause of your problem.
struct fileIndex *fIndex = NULL;
Unless you've included some headers you haven't shown, this shouldn't compile -- struct fileIndex doesn't seem to have been defined (nor does it seem to be defined anywhere I can see in the code you'e posted).
delimiters = " .,;:!-";/*strtok chars to seperate*/
int wCount = wordcount(file);/*number of words in file*/
This (wordcount) reads to the end of the file, but does not rewind the file afterward.
char **str[wCount+1];/*where the lines are being stored*/
From your description, you don't really have any need to store lines (plural) at all. What you probably want is to read one line, then tokenize it and insert the individual tokens (along with the line number) into your index, then read the next line. From what you've said, however, there's no real reason to store more than one raw line at a time though.
int j=0;
while(!feof(file)){/*inserting lines*/
As noted above, you've previously read to the end of the file, and never rewound the file. Therefore, nothing inside this loop should ever execute, because as soon as you get here, feof(file) should return true. When/if you take care of that, this loop won't work correctly -- in fact, a loop of the form while (!feof(file)) is essentially always wrong. Under the circumstances, you want to check the result of your fscanf, with something like:
while (1 == fscanf(file, "%1023s", line))
...so you exit the loop when attempting to read fails.
fscanf(file, "%s", &str[j]);
What you have here is basically equivalent to the notorious gets -- you've done nothing to limit the input to the size of the buffer. As shown above, you normally want to use %[some_number]s, where some_number is one smaller than the size of the buffer you're using (though, of course, to do that you do need a buffer, which you don't have either).
You've also done nothing to limit the number of lines to the amount of space you've allocated (but, as with the individual lines, you haven't allocated any). I almost hesitate to mention this, however, because (as mentioned above) from your description you don't seem to have any reason to store more than one line anyway.
Your code also leaks all the memory it allocates -- you have calls to malloc, but not a single call to free anywhere.
Actually, some of the advice above is (at last more or less) wrong. It's looking at how to fix an individual line of code, but in reality you probably want to structure the code a bit differently in general. Rather than read the file twice, once to count the words, then read it again to index the words, you probably want to read a line at a time (probably with fgets, then break the line into words, and count each word as you insert it into your index. Oh, and you almost certainly do not want to use a linked-list for your index either. A tree or a hash-table would make a great deal more sense for the job.
I also disagree with the suggestion(s) in the direction of using a debugger on this code. A debugger is not likely to lead toward significantly better code -- it may help you find a few of the localized problems, but is unlikely to lead toward a significantly better program. Instead, I'd suggest a pencil and a piece of paper as the tools you really need to use. I believe your current problems stem primarily for not having thought about the problem enough to really understand what steps are needed to accomplish the goal, and a debugger isn't likely to help much in finding an answer to that question.
If you don't have a good debugger handy, a good fallback is to simply add a few printf statements at steps through the code, so you can see how far it gets before crashing.
In this code:
char **str[wCount+1];/*where the lines are being stored*/
int j=0;
while(!feof(file)){/*inserting lines*/
fscanf(file, "%s", &str[j]);
j++;
}
str is an array of pointers to char *s. In your loop you are reading each piece of input into a slot in it. There are a couple of problems.
I think there's a miscount in the number of *s vs. &s (I don't usually program with that many levels of pointer indirection to avoid having to think so hard about them ;-). &str[j] is the address of that array element, but that array element is a pointer to a pointer; now you have a pointer to a pointer to a pointer. If you had instead char *str[wCount+1], and read into str[j], I think it might match up. (Also I don't use fscanf much, so perhaps someone can confirm how best to use it.)
More obviously, you're not actually allocating any memory for the string data. You're only allocating it for the array itself. You probably want to allocate a fixed amount for each one (you can do that in the loop before each fscanf call). Remember that you're fscanf could in practice read more than that fixed size, resulting in another memory error. Again, working around that requires an expert in fscanf usage.
Hope this helps for a start. If the printf suggestion finds a more specific point in the code where it fails, add that to the question.
Related
As an exercise, I have build a simple program that, given a text file of N lowercase words and whitespaces, populates a ragged array char *en[N].
It works without great problems, apart for one: it populates the ragged array with only the last word of the input.
#include<stdio.h>
#include<ctype.h>
int main(int argc, char *argv[]){
int i = 0, j = 0;
char *en[100];
char temp[20];
FILE *p = fopen(argv[1], "r");
char single;
while((single = fgetc(p)) != EOF){
if(!isspace(single)) /* Temporary store a single word */
temp[i++] = single;
else{
temp[i] = '\0';
en[j++] = temp; /* Save stored word in ragged array */
i = 0;
}
}
printf("%s\n", en[0]); /* Return the same than en[1] and en[99] */
printf("%s\n", en[1]);
printf("%s\n", en[99]);
return 0;
}
I cannot understand why it goes down to the end of the input file. I am unable of detecting major issues that could suggest a wrong approach.
Edit:
The reasoning behind my approach was that an array of *char can be initialized with this form:
p[0] = "abc";
reasoning that I wrongly tried to translate in the error above, that #coderredoc brilliantly caught. As far as the dimensions of single words and inputs are concerned, I admit I did not put many attention in them. The exercise is centered on a different topic. In any case, thanks a lot your your valuable suggestions!
Your array of charcaters are all pointing to the same char array and then the content of the array at last changes to the last word. And you get only the last word.
A possible solution
en[j++] = temp;
to
en[j++] = strdup(temp);
Then you will achieve the behavior you want your program to have.
You just found out the awesomeness of pointers, congratulations!
Seriously, char *en[100] is an array of pointers. en[j++] = temp; assigns the pointer to the first value of temp to a pointer at en[j++]. And you do this over and over again. No surprise that you end up with an array of pointers, all of which point to the same array temp, which holds the contents of the last word.
What to learn from this: a pointer merely points to some memory, and no memory copying happens when you do en[j++] = temp;. You have to allocate the memory yourself and copy temp to that new memory yourself.
I'm trying to learn some C and am having a little bit of trouble with manipulating strings. In trying to learn them, I've decided to make a simple spanish verb conjugator, but I'm getting stuck. Right now I'm just trying to drop the last 2 non '\0' of the string and then add a 'o' to it. (For example, for an input of "hablar" I want it to output "hablo"). Here's my code. I've tried to be overly detailed in my comments to hopefully aid in figuring out what I'm missing conceptually.
#include <stdio.h>
#include <string.h>
/* Reimplemented the length function of a string for practice */
int len(char *);
void conjugatePresentAr(char *, char *);
int len(char *arr){
int l = 0;
while (*arr++ != '\0'){
l++;
}
return l;
}
void conjugatePresentAr(char *verb, char *output){
output = verb;
int i = len(verb);
while (output < (verb + i -2)){
*output = *verb;
output++;
verb++;
}
*output = 'o';
output++;
*output = '\0';
}
int main(){
char input[20];
scanf("%s", input);
printf("%s\n",input);
char conjugated[20];
conjugatePresentAr(input, conjugated);
printf("%s\n", conjugated);
return 0;
}
For any input I get Segmentation Fault: 11. I've spent a decent amount of time looking around here and reading through books on pointers but can't quite seem to figure out what I'm messing up. I appreciate your help!
In conjugatePresentAr() you have changed the argument *output, possibly because you thought that copies the string.
output = verb;
so the function doesn't write anything to the string you supplied. Then when you print it, it's still an uninitialised variable.
int i = len(verb);
while (output < (verb + i -2)){
*output = *verb;
output++;
verb++;
}
will keep going forever: you're chasing (verb + i - 2) as it recedes into the distance (you increment verb inside the loop).
Try something like:
char *end = verb + strlen(verb) - 2;
while (output < end) {
...
verb++; /* this doesn't change end */
}
(and also fix the bug Weather Vane spotted which I entirely missed).
Note: in general, string processing is hard to do well in C, because the built-in facilities are so low-level. It's actually much easier to use C++ with its string and stringstream facilities.
If you're sticking to C, explicitly tracking length and allocated capacity alongside the char pointer (as the C++ string does for you) is good practice. Oh, and there's no obvious benefit to re-writing strlen.
You can't copy strings (char *) by assignment, like you did here:
output = verb;
What you do here is just change output to point at the input string, so any changes made to one of the strings will also apply to the other one - since they both point to the same memory.
you need to explicitly a function for copying the memory - such as strcpy (make sure to supply a null terminated string) or memcpy.
And, regarding your logic, since you don't really check the string for 'ar' in the end, and just assume there is, why not use something a little simpler like this:
void conjugatePresentAr(char *verb, char *output)
{
strcpy(output,verb);
int len = strlen(verb);
output[len - 2] = 'o';
output[len - 1] = '\0';
}
In function conjugatePresentAr() you have alterered the argument *output
output = verb;
Is an address affectation, not value.
Should reread pointer definition
For my assignment, I have to read in a text file with a varying amount of lines. They follow the following format:
AACTGGTGCAGATACTGTTGA
3
AACTGGTGCAGATACTGCAGA
CAGTTTAGAG
CATCATCATCATCATCATCAT
The first line is the original line I will testing the following ones against, with the second line giving the number of remaining lines.
I'm having trouble trying to save these to a struct, and can't even get the first line to save. I tried using the void function with an array and it seems to work, but can't seem to transfer it over to structs.
Here's my code so far:
#include <stdlib.h>
#include <stdio.h>
#include <string.h>
#define LENGTH 25
struct dna {
char code[LENGTH];
};
int main(){
char filename[] = "input1.txt";
FILE *input = fopen("input1.txt","r");
char firstDna[LENGTH]="";
struct dna first;
struct dna first.code[]= "";
makeArray(input,first);
// printf("%s",filename);
system("pause");
return 0;
}
void makeArray(FILE *input,struct dna first){
int i=-1;
//nested for loops to initialze array
//from file
while(i != '\n'){
fscanf(input,"%c",first[i].code);
printf("%c", first[i].code);
i++;
}//closing file
fclose(input);
}
Since this is for a class assignment, I want to preface this by saying that a good way to tackle these types of assignments is to break it up into tasks, then implement them one by one and finally connect them. In this case the tasks might be something like:
parse the first line into a (struct containing a) char array.
parse the number into an int variable
parse each remaining line in the file like you did with the first line
test the first line against the other lines in the file (except the number)
You also mentioned in a comment that the struct is for extra credit. For that reason, I'd recommend implementing it using just a char array first, then refactoring it into a struct once you have the basic version working. That way you have something to fall back on just in case. This way of developing might seem unnecessary at this point, but for larger more complicated projects it becomes a lot more important, so it's a really good habit to get into as early as possible.
Now, let's look at the code. I'm not going to give you the program here, but I'm going to identify the issues I see in it.
Let's start with the main method:
char filename[] = "input1.txt";
FILE *input = fopen("input1.txt","r");
This opens the file you're reading from. You're opening it correctly, but the first line is in this case unnecessary, since you never actually use the filename variable anywhere.
You also correctly close the file at the end of the makeArray function with the line:
fclose(input);
Which works. It would, however, probably be better style if you put this in the main method after calling the makeArray function. It's always a good idea to open and close files in the same function if possible, since this means you will always know you didn't forget to close the file without having to look through your entire program. Again, not really an issue in a small project, but a good habit to get into. Another solution would be to put the fopen and fclose functions in the makeArray function, so main doesn't have to know about them, then just send the char array containing the filepath to makeArray instead of the FILE*.
The next issue I see is with how you are passing the parameters to the makeArray function. To start off, instead of having a separate function, try putting everything in the main method. Using functions is good practice, but do this just to get something working.
Once that's done, something you need to be aware of is that if you're passing or returning arrays or pointers to/from functions, you will need to look up the malloc and free functions, which you may not have covered yet. This can be one of the more complex parts of C, so you might want to save this for last.
Some other things. I won't go into detail about these but try to get the concepts and not just copy paste:
struct dna first.code[]= ""; should probably be first.code[0] = \0;. \0 is used in C to terminate strings, so this will make the string empty.
Passing %c to fscanf reads a single character (you can also use fgetc for this). In this case, it will probably be easier using %s, which will return a word as a string.
Assuming you do use %s, which you probably should, you will need to call it twice before the loop - once to get the first DNA sequence and another time to get the number of other DNA sequences (the number of iterations).
Each iteration of the loop will then test the original DNA sequence against the next DNA sequence in the file.
I hope that helps!
sample to fix
#include <stdlib.h>
#include <stdio.h>
#include <string.h>
#define LENGTH 25
struct dna {
char code[LENGTH];
};
struct dna *makeArray(FILE *input, int *n);//n : output, number of elements
int main(void){
char filename[] = "input1.txt";
FILE *input = fopen(filename,"r");
struct dna first = { "" };
fscanf(input, "%24s", first.code);//read first line
printf("1st : %s\n", first.code);
int i, size;
struct dna *data = makeArray(input, &size);//this does close file
for(i = 0; i < size; ++i){
printf("%3d : %s\n", i+1, data[i].code);
}
free(data);//release data
system("pause");
return 0;
}
struct dna *makeArray(FILE *input, int *n){//n : output, number of elements
int i;
fscanf(input, "%d", n);//read "number of remaining lines"
struct dna *arr = calloc(*n, sizeof(struct dna));//like as struct dna arr[n] = {{0}};
for(i = 0; i < *n; ++i){
fscanf(input, "%24s", arr[i].code);
}
fclose(input);
return arr;
}
a simple fix might be :
#include <stdlib.h>
#include <stdio.h>
#include <string.h>
#define LENGTH 25
struct dna {
char code[LENGTH];
};
void makeArray(FILE *input,struct dna *first){
int i=0;
fscanf(input,"%c",&first->code[i]);
printf("%c",first->code[i]);
while(first->code[i] != '\n' && i < LENGTH){
i++;
fscanf(input,"%c",&first->code[i]);
printf("%c",first->code[i]);
}
}
int main() {
struct dna first;
char filename[] = "input1.txt";
FILE *input = fopen(filename,"r");
makeArray(input,&first);
fclose(input);
printf("%s",first.code);
return 0;
}
PS: i tried to not change your original code
in order to change the code[Length] in the makeArray function you will have to pass it's adresse this is why i call mkaeArray function this way : makeArray(input,&first);.
I'm trying to write a stream editor in C and I'm having a hard time dealing with strings. After reading in the lines of a File, I want to store them locally in an array of Strings. However, when I try to store the variable temp into the array of strings StoredEdits I get a segmentation fault (core dumped) error. Furthermore, if I uncomment the char* temp2 variable and save this into my array as a workaround, then the last value read in gets stored for every value in the array.
I assume this has to do with the fact that temp2 is a pointer. I've tried a million things like malloc'ing and free'ing this variable after each iteration, but nothing seems to work.
Any help would be greatly appreciated.
#define MAX_SIZE 100
typedef char String[MAX_SIZE];
int main(int argc, char* argv[]){
char** StoredEdits;
int index, numOfEdits;
FILE *EditFile;
char* temp;
//char* temp2;
StoredEdits = (char**)malloc(MAX_INPUT_SIZE*sizeof(String));
/*Check to see that edit file is passed in.*/
if(argc < 2){
printf("ERROR: Edit File not given\n");
return(EXIT_FAILURE);
}
printf("%s\n",argv[1]);
if( (EditFile = fopen(argv[1],"r")) != NULL ){
printf("file opened\n");
numOfEdits = 0;
while(fgets(temp, MAX_STRING_SIZE, EditFile) != NULL){
printf("%d %s",numOfEdits,temp);
//temp2 = temp;
StoredEdits[numOfEdits++] = temp;
//StoredEdits[numOfEdits++] = temp;
printf("Stored successfully\n");
}
..........
printf("%d\n",numOfEdits);
for(index=0;index<numOfEdits;index++){
printf("%d %s\n",index, StoredEdits[index]);
}
You need to initialize temp to point to valid storage.
temp = malloc(MAX_STRING_SIZE+1);
It looks like you may have intended to do something like this:
String temp;
using your macro. This would be better as a regular char array. And the common name for this is buffer.
char buffer[MAX_STRING_SIZE+1];
Then, you should store in your array, not temp itself, but a new string containing a copy of the contents. There is a POSIX function strdup that should be helpful here. Note, strdup is not part of the C standard, but it is available in most hosted implementations. Historically, it comes from the BSD branch.
StoredEdits[numOfEdits++] = strdup(temp);
Let me backpedal a little and say that if you're allocating new storage for temp inside the loop, then you should skip the strdup because, as Jim Balter says, this will leak memory. If you allocate temp outside of the loop, then it makes little difference whether you allocate it statically (by declaring a char []) or dynamically (with malloc).
By the way, this line will not buy you much:
typedef char String[MAX_SIZE];
For why, see the classic Kernighan (the K in K&R) essay Why Pascal is not my favorite Programming Language.
Also note, that my examples above do not check the pointer returned by malloc. malloc can fail. When malloc fails it will return a NULL pointer. If you try to store data through this pointer, Kaboom!
You're right about your problem being because of pointer semantics. You should use copy the contents of the string from temp.
char *cpy = malloc(1 + strlen(temp));
if (cpy)
strcpy(cpy, temp);
//else handle error
StoredEdits[numOfEdits++] = cpy;
Others answered the reason for the error.
But from the program, i see that you tried to allocate a character double array. then you store each line read from the file into the array.
StoredEdits = (char**)malloc(MAX_INPUT_SIZE*sizeof(String));
if my assumption is right, then you should pass the array into strcpy like the below.
strcpy(StoredEdits[numOfEdits],tmp);
when you have a file where each line varies in size, it is better to go array of pointers points to character array.
I need a function/method that will take in a char array and set it to a string read from stdin. It needs to return the last character read as its return type, so I can determine if it reached the end of a line or the end of file marker.
here is what I have so far, and I kind of based it off of code from here
UPDATE: I changed it, but now it just crashes upon hitting enter after text. I know this way is inefficient, and char is not the best for EOF check, but for now I am just trying to get it to return the string. I need it to do it in this fashion and no other fashion. I need the string to be the exact length of the line, and to return a value that is either the newline or EOF int which I believe can still be used in a char value.
This program is in C not C++
char getLine(char **line);
int main(int argc, char *argv[])
{
char *line;
char returnVal = 0;
returnVal = getLine(&line);
printf("%s", line);
free(line);
system("pause");
return 0;
}
char getLine(char **line) {
unsigned int lengthAdder = 1, counter = 0, size = 0;
char charRead = 0;
*line = malloc(lengthAdder);
while((charRead = getc(stdin)) != EOF && charRead != '\n')
{
*line[counter++] = charRead;
*line = realloc(*line, counter);
}
*line[counter] = '\0';
return charRead;
}
Thank you for any help in advance!
You're assigning the result of malloc() to a local copy of line, so after the getLine() function returns it's not modified (albeit you think it is). What you have to do is either return it (as opposed to use an output parameter) or pass its address (pass it 'by reference'):
void getLine(char **line)
{
*line = malloc(length);
// etc.
}
and call it like this:
char *line;
getLine(&line);
Your key problem is that line pointer value does not propagate out of the getLine() function. The solution is to pass pointer to the line pointer to the function as a parameter instead - calling it like getLine(&line); while the function would be defined as taking parameter char **line. In the function, on all places where you now work with line, you would work with *line instead, i.e. dereferencing the pointer to a pointer and working with the value of the variable in main() where the pointer leads. Hope this is not too confusing. :-) Try to draw it on a piece of paper.
(A tricky part - you must change line[counter] to (*line)[counter] because you first need to dereference the pointer to the string, and only then to access a specific character in the string.)
There is a couple of other problems with your code:
You use char as the type for charRead. However, the EOF constant cannot be represented using char, you need to use int - both as the type of charRead and return value of getLine(), so that you can actually distringuish between a newline and end of file.
You forgot to return the last char read from your getLine() function. :-)
You are reallocating the buffer after each character addition. This is not terribly efficient and therefore is a rather ugly programming practice. It is not too difficult to use another variable to track the amount of space allocated and then (i) start with allocating a reasonable chunk of memory, e.g. 64 bytes, so that ideally you will never reallocate (ii) enlarge the allocation only if you need to based on comparing the counter and your allocation size tracker. Two reallocation strategies are common - either doubling the size of the allocation or increasing the allocation by a fixed step.
The way you use realloc is not correct. If it returns NULL then the memory block will be lost.
It is better to use realloc in this way:
char *tmp;
...
tmp = realloc(line, counter);
if(tmp == NULL)
ERROR, TRY TO SOLVE IT
line = tmp;