I have this 2D array.
[(476301.98163511883, 6176897.129456658)
(476723.365551495, 6176895.078376785)
(477124.59457628336, 6176893.28525448)
(477525.82249430567, 6176891.306532074)
(477927.0510582989, 6176889.4760845825)
(477925.0121537624, 6176487.379134962)
(477922.97333802003, 6176085.2824224755)
(477920.93404681794, 6175683.074655607)
(477918.79328165855, 6175260.834659822)]
I'm trying to add 10 to "X" the first column and 20 to the "Y" column. I can't figure out how to access each column while keeping the array structure as is.
I can do something like this
x = array['X'] + 10
y = array['Y'] + 20
However now the array is split and a need the x, y pair together like in the original array. Thanks
I guess your columns are named 'X' and 'Y', and that array is a numpy.array?
In that case you can edit inplace by using the += operator:
array['X'] += 10
array['Y'] += 20
or, if they are not named
array[:, 0] += 10
array[:, 1] += 20
This is the same as
array['X'] = array['X'] + 10
Related
Two questions, one fairly simple question (at least it seems it should be simple) and one that may take a bit more work. Feel free to contribute to either or both.
First, I'd like to create a string array based off of an existing string array based on a criteria. Take for example a similar operation with a double array:
>> nums = [ 1 2 1 2]
nums =
1 2 1 2
>> big_nums = (nums == 2) .* nums
big_nums =
0 2 0 2
I'd like to do something similar with a string array, however I don't know what function to use:
>> sizes = ["XL" "L" "XL" "L"]
sizes =
1×4 string array
"XL" "L" "XL" "L"
>> large_sizes = (sizes == "L") .* sizes
Undefined operator '.*' for input arguments of type 'string'.
I'd like the output to be
large_sizes =
1×4 string array
"" "L" "" "L"
Second question. Suppose I have a 2 dimensional cell array. I'd like to filter data based on criteria:
>> data = {"winter", 1; "spring", 2; "summer", 3; "fall", 4}
data =
4×2 cell array
["winter"] [1]
["spring"] [2]
["summer"] [3]
["fall" ] [4]
>> nice_weather = ( (data(1,:) == "fall") + (data(1,:) == "spring") ) .* data
Error using ==
Cell must be a cell array of character vectors.
I'd like a code that results in one of two arrays:
nice_weather =
4×2 cell array
[""] [1]
["spring"] [2]
[""] [3]
["fall"] [4]
----- OR -----
nice_weather =
2×2 cell array
["spring"] [2]
["fall"] [4]
For this question, I am also open to separating data into multiple arrays (for example, one array for strings and one array for numbers).
Thanks!
This solution uses the strcmpi function from MATLAB (no toolbox required) to compare two strings (insensitive to the case).
1D Cell Array:
sizes = {'XL' 'L' 'XL' 'L'}; % Changed " to ' & used cell array
idx = strcmpi(sizes,'L'); % Logical index
sizelist = {sizes{idx}}
Or you could try something like
sizes(~idx) = {"" ""} % manual just for example
For this to automatically adjust the number of blanks "", you could use repmat like this
sizes(~idx) = repmat({""},1,sum(~idx))
Output:
sizes = 1×4 cell array
{[""]} {'L'} {[""]} {'L'}
2D Cell Array:
data = {'winter', 1; 'spring', 2; 'summer', 3; 'fall', 4}; % Changed " to '
nicemo1 = 'spring';
nicemo2 = 'fall';
idx = strcmpi(data(:,1),nicemo1) | strcmp(data(:,1),nicemo2); % Obtain logical index
data(idx,:)
Output:
ans = 2×2 cell array
{'spring'} {[2]}
{'fall' } {[4]}
Tested with MATLAB R2018b.
Also beware variables like sizes as dropping a letter masks a useful function, size.
I have multiple array, number can be arbitrary. but the size of all array is same. How do i add each element of with respective element of all the arrays and maybe save it in another array
A1 = [1 2 3 4 5 6]
A2 = [1 2 3 4 5 6]
.
.
.
.
final = [1+1+1+... 2+2+2+.... 3+3+3+3.... 4+4+4.... 5+5+5+5... 6+6+6+6...]
As your arrays are all the same length you can just add the arrays forming a new array.
final = A1+A2
This function searches in your workspace looking for all variables containing capital 'A'. The for loop adds all found variables. If there are other variables containing 'A', other restrictions has to be made.
variables = who %# all variable names from workspace
index = strmatch('A',variables) %# indices matching "A"
newarray = 0
for j = 1:numel(index)
tmp = eval(char(variables(index(j)))); %# store variable in tmp
newarray = newarray + tmp; %# sum
end
If you have an unknown number of A's, you can try something like this:
final = 0
i = 1
while exist(['A' num2str(i)]) == 1 % ['A' num2str(i)] constructs the variable name, eval calls it
final = final + eval(['A' num2str(i)]);
i = i + 1;
end
This should work as long as the variables are stored in the workspace, are of the same length and are named A1, A2, A3, ... A9, A10, ...
Let's say you have this structure (as you write in the comments):
main = struct('err',{1:6,5:10,1:6,1:6},'seg_err',{1:6,5:10,1:6,5:10});
you can convert it to matrix:
m = vertcat(main.seg_err);;
And than take the sum in a simple command:
final = sum(m)
which results:
final =
12 16 20 24 28 32
and thanks to #beaker :)
Say, we have an array of structs
data = struct('position',[]);
data(1,1).position = 11;
data(1,2).position = 12;
data(2,1).position = 21;
data(2,2).position = 22;
I learned that to get the entries from a field from all structs in the array, we can use
>> [data.position]
ans =
11 21 12 22
But this gives the data in a row. How can we get it in the original shape of the array, without looping the array in MCode?
Desired output:
position =
11 12
21 22
Use reshape. This will restructure an input vector / matrix into another vector / matrix of a desired shape. Specifically, you can specify the dimensions of data into reshape as well as the row vector produced by [data.position] and it'll reshape the vector with the right dimensions for you.
data = struct('position',[]);
data(1,1).position = 11;
data(1,2).position = 12;
data(2,1).position = 21;
data(2,2).position = 22;
position = reshape([data.position], size(data))
position =
11 12
21 22
Note that the elements are shaped in column-major format so the values are stacked column-wise. As you can see, the first two elements become the first column of the output matrix, while the last two elements become the second column of the output matrix.
If you are working with empty entries, you can use struct2cell to convert the struct data into cell array that enables us to store empty entries as empty cells -
data_cell = permute(struct2cell(data),[2 3 1])
out = data_cell(:,:,strcmp(fieldnames(data),'position'))
So, if you have something like this with the (2,2) missing -
data = struct('position',[]);
data(1,1).position = 11;
data(1,2).position = 12;
data(2,1).position = 21;
You would have -
out =
[11] [12]
[21] []
Based on #CitizenInsane's nice observation and which might be very close to #rayryeng's answer, but one that deals with cell arrays instead of numeric arrays, would be this -
out = reshape({data.position}, size(data))
I have 64 characters in a 4*4 matrix.I need to convert it into a cell array such that cell has 4 characters.For eg
Consider A=[TCTGCTCTCGGTTATATACACTGCCCAGAACACGTCAACAAGGCCAGTGTATCCTTCTTTGTGT]
i need to get a cell array as below
B={[TCTG][CTCT][CGGT][TATA]
[TACA][CTGC][CCAG][AACA]
[CGTC][AACA][AGGC][CAGT]
[GTAT][CCTT][CTTT][GTGT]}
i tried using the mat2cell function but im not able to understand it.please help.
Using a for-loop:
clc
clear
A = 'TCTGCTCTCGGTTATATACACTGCCCAGAACACGTCAACAAGGCCAGTGTATCCTTCTTTGTGT';
B = cell(4,4);
currentIdx = 0; % Use index to increment by steps of 4 when going through A
for k = 1:16
B{k} = A(currentIdx+1:currentIdx+4);
currentIdx = currentIdx+4;
end
B = B'
B =
'TCTG' 'CTCT' 'CGGT' 'TATA'
'TACA' 'CTGC' 'CCAG' 'AACA'
'CGTC' 'AACA' 'AGGC' 'CAGT'
'GTAT' 'CCTT' 'CTTT' 'GTGT'
You are starting with a 1xN matrix and want to convert it to a 1xN/4 cell array of 1x4 matrices. Your command should then be:
N = length(A);
M = 4;
B = mat2cell(A,1,ones(1,N/M)*M);
The first dimension is the 1, the second dimension is a string of 4's the size of the output cell array. The result:
B =
Columns 1 through 12
'TCTG' 'CTCT' 'CGGT' 'TATA' 'TACA' 'CTGC' 'CCAG' 'AACA' 'CGTC' 'AACA' 'AGGC' 'CAGT'
Columns 13 through 16
'GTAT' 'CCTT' 'CTTT' 'GTGT'
You can use method vec2mat that breaks your input vector to matrix
M = vec2mat(A, numberOfColumns)
(In your case numberOfColumns would be 16) and then use mat2cell. In your case, it would be:
C = mat2cell(M, [1,1,1,1], [4,4,4,4])
It means that all cels will have one row and 4 columns).
Effect of function c = mat2cell(x, [10, 20, 30], [25, 25]) would be:
The image shows why you have to convert vector to matrix. (example from matlab documentation)
You can also (ab)use the very versatile accumarray for this task:
A = 'TCTGCTCTCGGTTATATACACTGCCCAGAACACGTCAACAAGGCCAGTGTATCCTTCTTTGTGT';
n = 4;
B = accumarray(ceil(1/n:1/n:numel(A)/n).', A(:), [], #(x) {x.'}).'
Hi I have an three dimensional octave array A of size [x y z]
Now I have another array B of dimensions n * 3
say B(0) gives [3 3 1]
I need to access that location in A ie A(3, 3, 1) = say 15
something like A(B(0))
How do I go about it?
See the help for sub2ind (and ind2sub).
However, nowadays people recommend to use loops.
Well, first, B(0) is invalid index, as addressing in MATLAB and Octave begins from 1. Other issue is that you want that B(0) would contain a vector [3 3 1 ]. Matrices in MATLAB can not contain other matrices, only scalars. So you need to use a 3x3 cell array, a 3x3 struct or a 4-dimensional array. I'll choose here the cell array option, because I find it easiest and most convenient.
% Set random seed (used only for example data generation).
rng(123456789);
% Let's generate some pseudo-random example data.
A = rand(3,3,3);
A(:,:,1) =
0.5328 0.7136 0.8839
0.5341 0.2570 0.1549
0.5096 0.7527 0.6705
A(:,:,2) =
0.6434 0.8185 0.2308
0.7236 0.0979 0.0123
0.7487 0.0036 0.3535
A(:,:,3) =
0.1853 0.8994 0.9803
0.7928 0.3154 0.5421
0.6122 0.4067 0.2423
% Generate an example 3x3x3 cell array of indices, filled with pseudo-random 1x3 index vectors.
CellArrayOfIndicesB = cellfun(#(x) randi(3,1,3), num2cell(zeros(3,3,3)), 'UniformOutput', false);
% Example #1. Coordinates (1,2,3).
Dim1 = 1;
Dim2 = 2;
Dim3 = 3;
% The code to get the corresponding value of A directly.
ValueOfA = A(CellArrayOfIndicesB{Dim1,Dim2,Dim3}(1), CellArrayOfIndicesB{Dim1,Dim2,Dim3}(2), CellArrayOfIndicesB{Dim1,Dim2,Dim3}(3));
ValueOfA =
0.8839
% Let's confirm that by first checking where CellArrayOfIndicesB{1,2,3} points to.
CellArrayOfIndicesB{1,2,3}
ans =
[ 1 3 1 ]
% CellArrayOfIndicesB{1,2,3} points to A(1,3,1).
% So let's see what is the value of A(1,3,1).
A(1,3,1)
ans =
0.8839
% Example #2. Coordinates (3,1,2).
Dim1 = 3;
Dim2 = 1;
Dim3 = 2;
ValueOfA = A(CellArrayOfIndicesB{Dim1,Dim2,Dim3}(1), CellArrayOfIndicesB{Dim1,Dim2,Dim3}(2), CellArrayOfIndicesB{Dim1,Dim2,Dim3}(3));
ValueOfA =
0.4067
CellArrayOfIndicesB{3,1,2}
ans =
[ 3 2 3 ]
A(3,2,3)
ans =
0.4067