Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Questions asking for code must demonstrate a minimal understanding of the problem being solved. Include attempted solutions, why they didn't work, and the expected results. See also: Stack Overflow question checklist
Closed 9 years ago.
Improve this question
Can anyone tell me how to find (2^101100111000)%1000000007 in C?
There is a problem in which we have to convert a number into binary(1<=N<=600000) and find
2^(binary representation of N)modulo1000000007.
The values you are talking about will not fit into a standard long on any architecture, so you will have to use an arbitrary precision maths library such as GMP.
Hmm, just read Zong's answer... he's pointing to a more efficient method... haven't finished reading through the article but it looks like the better way to go...
Related
Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
This question appears to be off-topic because it lacks sufficient information to diagnose the problem. Describe your problem in more detail or include a minimal example in the question itself.
Closed 8 years ago.
Improve this question
I would like to compare two dna sequences in C. How can i compare two strings and gets the difference?
Let's say:
seq_a:
GATCAACGCAAAGGACTAAGCACTGCTGCCAAA
and
seq_b:
GATCAACGCAAAGGACTAAGCACTGCTGCCTGC
result: TGC or GATCAACGCAAAGGACTAAGCACTGCTGCC***
Hard-code the traversal of two strings in a while loop. If they're the same, output either string1[i] or string2[i]. If they're different, write a star.
Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Closed 8 years ago.
This question appears to be off-topic because it lacks sufficient information to diagnose the problem. Describe your problem in more detail or include a minimal example in the question itself.
Questions asking for code must demonstrate a minimal understanding of the problem being solved. Include attempted solutions, why they didn't work, and the expected results. See also: Stack Overflow question checklist
Improve this question
my input is of form of: number:number for example 16:13
my goal is to take this input and break it to the two numbers.
for example first number is 16, second number is 13.
is there a way to use SCANF to read the numbers directly? or the only was is to use a function to convert the string to numbers after i lose the separator?
i can not change the format of the input.
This should do the trick.
scanf_s("%d:%d", &num1, &num2);
Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Questions asking for code must demonstrate a minimal understanding of the problem being solved. Include attempted solutions, why they didn't work, and the expected results. See also: Stack Overflow question checklist
Closed 9 years ago.
Improve this question
I found this line in Linux Audio drivers soc-core.c inside sound folder:
int regsize = codec->driver->reg_word_size * 2;
Can anybody please explain the meaning of * 2?
Multiply the contents of codec->driver->reg_word_size by 2. I guess this is a translation between size in words to size in bytes.
Multiplies that value by 2. That's all it does
Well, I can just guess, but it looks like this:
codec is a pointer to a structure, which has a pointer to another structure in driver, which has a member variable reg_word_size (which it seems is, like the name says, the size of a register word). This value gets doubled (*2).
This could be, like the other answer says, a conversion between bytes and words. However, it could probably also just mean that this regsize should be twice as big as the reg_word_size.
Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Closed 8 years ago.
This question appears to be off-topic because it lacks sufficient information to diagnose the problem. Describe your problem in more detail or include a minimal example in the question itself.
Questions asking for code must demonstrate a minimal understanding of the problem being solved. Include attempted solutions, why they didn't work, and the expected results. See also: Stack Overflow question checklist
Improve this question
I'm a C beginner and I'm learning "heap" currently. One thing confuse me is can we store an array in heap? If we can, how?
Say for example:
int main(void) {
char sentence[] = "Please move me to heap.";// I want to store this sentence in heap
printf("%s\n", sentence);
}
Can somebody clarify this point to me? Thanks in advance.
Please have a look at this C tutorial and then have a look at malloc.
There is an example use of malloc here. If you are learning, it is better to read a slightly longer tutorial than for us to give you the answer in code as the former will better your understanding.
Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Questions asking for code must demonstrate a minimal understanding of the problem being solved. Include attempted solutions, why they didn't work, and the expected results. See also: Stack Overflow question checklist
Closed 9 years ago.
Improve this question
I am looking for a package, or easy implementation of CRC 16-bit code by MATLAB
How about file exchange?
http://www.mathworks.com/matlabcentral/fileexchange/20350-16-bit-itu-t-crc