Where can I get a CRC (Cyclic Redundancy Check ) code? [closed] - c

Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Questions asking for code must demonstrate a minimal understanding of the problem being solved. Include attempted solutions, why they didn't work, and the expected results. See also: Stack Overflow question checklist
Closed 9 years ago.
Improve this question
I am looking for a package, or easy implementation of CRC 16-bit code by MATLAB

How about file exchange?
http://www.mathworks.com/matlabcentral/fileexchange/20350-16-bit-itu-t-crc

Related

Comparison of two dna sequences in C [closed]

Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
This question appears to be off-topic because it lacks sufficient information to diagnose the problem. Describe your problem in more detail or include a minimal example in the question itself.
Closed 8 years ago.
Improve this question
I would like to compare two dna sequences in C. How can i compare two strings and gets the difference?
Let's say:
seq_a:
GATCAACGCAAAGGACTAAGCACTGCTGCCAAA
and
seq_b:
GATCAACGCAAAGGACTAAGCACTGCTGCCTGC
result: TGC or GATCAACGCAAAGGACTAAGCACTGCTGCC***
Hard-code the traversal of two strings in a while loop. If they're the same, output either string1[i] or string2[i]. If they're different, write a star.

C - Why the size_t is unrecognized in eclipse? [closed]

Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Questions asking for code must demonstrate a minimal understanding of the problem being solved. Include attempted solutions, why they didn't work, and the expected results. See also: Stack Overflow question checklist
Closed 9 years ago.
Improve this question
In eclipse it don't recognize the type size_t, it write error on it and a message uknown type name 'size_t',
it is written right
size_t comes from stddef.h standard header file. You have to include it. You can also get it from stdio.h where it is also declared.

Is process in an infinite loop? [closed]

Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Questions concerning problems with code you've written must describe the specific problem — and include valid code to reproduce it — in the question itself. See SSCCE.org for guidance.
Closed 9 years ago.
Improve this question
How can I check if a process is in an infinite loop ?
how the scheduler will come to high priority process that is waiting ?
Its a question I gon in a job interview ...
thanks
It was proven in 1936 that it is impossible in general to check if a process is in an infinite loop. That is a trick question.
The other question has nothing to do with this question.

Two to the power of some large number [closed]

Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Questions asking for code must demonstrate a minimal understanding of the problem being solved. Include attempted solutions, why they didn't work, and the expected results. See also: Stack Overflow question checklist
Closed 9 years ago.
Improve this question
Can anyone tell me how to find (2^101100111000)%1000000007 in C?
There is a problem in which we have to convert a number into binary(1<=N<=600000) and find
2^(binary representation of N)modulo1000000007.
The values you are talking about will not fit into a standard long on any architecture, so you will have to use an arbitrary precision maths library such as GMP.
Hmm, just read Zong's answer... he's pointing to a more efficient method... haven't finished reading through the article but it looks like the better way to go...

How is it valid code in c? It seems to execute fine [closed]

Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Questions asking for code must demonstrate a minimal understanding of the problem being solved. Include attempted solutions, why they didn't work, and the expected results. See also: Stack Overflow question checklist
Closed 9 years ago.
Improve this question
The following code seems to execute fine but how is it valid and whats happening here?
int i;
printf("%d",i["11"]);
i["11"] == *("11" + i) == "11"[i]
when you do i["11"] what you do is say to the compiler to take the value of i and add to it the value of "11" and take the value on the address that is the sum of them

Resources