Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Questions asking for code must demonstrate a minimal understanding of the problem being solved. Include attempted solutions, why they didn't work, and the expected results. See also: Stack Overflow question checklist
Closed 9 years ago.
Improve this question
In eclipse it don't recognize the type size_t, it write error on it and a message uknown type name 'size_t',
it is written right
size_t comes from stddef.h standard header file. You have to include it. You can also get it from stdio.h where it is also declared.
Related
Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Questions concerning problems with code you've written must describe the specific problem — and include valid code to reproduce it — in the question itself. See SSCCE.org for guidance.
Closed 9 years ago.
Improve this question
I have experienced a strange problem when using assert in my program.
The program does not terminate even when I add a line of codeassert(false).
But the assert works when I write several lines of sample code. Anybody know why it happened?
If you have:
#define NDEBUG
this turns all assert's into nop's.
If you have differing behaviour, depending on the amount of code, then I guess you don't have NDEBUG defined and I would guess the compiler is simply compiling out the redundant code.
More details about environment are required, however, you give a definitive answer.
Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
This question appears to be off-topic because it lacks sufficient information to diagnose the problem. Describe your problem in more detail or include a minimal example in the question itself.
Closed 8 years ago.
Improve this question
I would like to compare two dna sequences in C. How can i compare two strings and gets the difference?
Let's say:
seq_a:
GATCAACGCAAAGGACTAAGCACTGCTGCCAAA
and
seq_b:
GATCAACGCAAAGGACTAAGCACTGCTGCCTGC
result: TGC or GATCAACGCAAAGGACTAAGCACTGCTGCC***
Hard-code the traversal of two strings in a while loop. If they're the same, output either string1[i] or string2[i]. If they're different, write a star.
Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Questions asking for code must demonstrate a minimal understanding of the problem being solved. Include attempted solutions, why they didn't work, and the expected results. See also: Stack Overflow question checklist
Closed 9 years ago.
Improve this question
Can anyone tell me how to find (2^101100111000)%1000000007 in C?
There is a problem in which we have to convert a number into binary(1<=N<=600000) and find
2^(binary representation of N)modulo1000000007.
The values you are talking about will not fit into a standard long on any architecture, so you will have to use an arbitrary precision maths library such as GMP.
Hmm, just read Zong's answer... he's pointing to a more efficient method... haven't finished reading through the article but it looks like the better way to go...
Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Questions asking for code must demonstrate a minimal understanding of the problem being solved. Include attempted solutions, why they didn't work, and the expected results. See also: Stack Overflow question checklist
Closed 9 years ago.
Improve this question
The following code seems to execute fine but how is it valid and whats happening here?
int i;
printf("%d",i["11"]);
i["11"] == *("11" + i) == "11"[i]
when you do i["11"] what you do is say to the compiler to take the value of i and add to it the value of "11" and take the value on the address that is the sum of them
Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
Questions asking for code must demonstrate a minimal understanding of the problem being solved. Include attempted solutions, why they didn't work, and the expected results. See also: Stack Overflow question checklist
Closed 9 years ago.
Improve this question
I am looking for a package, or easy implementation of CRC 16-bit code by MATLAB
How about file exchange?
http://www.mathworks.com/matlabcentral/fileexchange/20350-16-bit-itu-t-crc