I'm working on "Move Zeroes" of leetcode with scala. https://leetcode.com/problems/move-zeroes/description/
Given an array nums, write a function to move all 0's to the end of it while maintaining the relative order of the non-zero elements. You must do this in-place without making a copy of the array.
I have a solution which works well in IntelliJ but get the same Array with input while executing in Leetcode, also I'm not sure whether it is done in-place... Something wrong with my code ?
Thanks
def moveZeroes(nums: Array[Int]): Array[Int] = {
val lengthOrig = nums.length
val lengthFilfter = nums.filter(_ != 0).length
var numsWithoutZero = nums.filter(_ != 0)
var numZero = lengthOrig - lengthFilfter
while (numZero > 0){
numsWithoutZero = numsWithoutZero :+ 0
numZero = numZero - 1
}
numsWithoutZero
}
And one more thing: the template code given by leetcode returns Unit type but mine returns Array.
def moveZeroes(nums: Array[Int]): Unit = {
}
While I agree with #ayush, Leetcode is explicitly asking you to use mutable states. You need to update the input array so that it contains the changes. Also, they ask you to do that in a minimal number of operations.
So, while it is not idiomatic Scala code, I suggest you a solution allong these lines:
def moveZeroes(nums: Array[Int]): Unit = {
var i = 0
var lastNonZeroFoundAt = 0
while (i < nums.size) {
if(nums(i) != 0) {
nums(lastNonZeroFoundAt) = nums(i)
lastNonZeroFoundAt += 1
}
i += 1
i = lastNonZeroFoundAt
while(i < nums.size) {
nums(i) = 0
i += 1
}
}
As this is non-idomatic Scala, writing such code is not encouraged and thus, a little bit difficult to read. The C++ version that is shown in the solutions may actually be easier to read and help you to understand my code above:
void moveZeroes(vector<int>& nums) {
int lastNonZeroFoundAt = 0;
// If the current element is not 0, then we need to
// append it just in front of last non 0 element we found.
for (int i = 0; i < nums.size(); i++) {
if (nums[i] != 0) {
nums[lastNonZeroFoundAt++] = nums[i];
}
}
// After we have finished processing new elements,
// all the non-zero elements are already at beginning of array.
// We just need to fill remaining array with 0's.
for (int i = lastNonZeroFoundAt; i < nums.size(); i++) {
nums[i] = 0;
}
}
Your answer gives TLE (Time Limit Exceeded) error in LeetCode..I do not know what the criteria is for that to occur..However i see a lot of things in your code that are not perfect .
Pure functional programming discourages use of any mutable state and rather focuses on using val for everything.
I would try it this way --
def moveZeroes(nums: Array[Int]): Array[Int] = {
val nonZero = nums.filter(_ != 0)
val numZero = nums.length - nonZero.length
val zeros = Array.fill(numZero){0}
nonZero ++ zeros
}
P.S - This also gives TLE in Leetcode but still i guess in terms of being functional its better..Open for reviews though.
first question ever here...
I am coding a simple 3-card poker hand evaluator and am having problems finding/extracting multiple "straights" (sequential series of values) from an array of values.
I need to extract and return EVERY straight the array possibly has. Here's an example:
(assume array is first sorted numerically incrementing)
myArray = [1h,2h,3c,3h,4c]
Possible three-value sequences are:
[1h,2h,3c]
[1h,2h,3h]
[2h,3c,4c]
[2h,3h,4c]
Here is my original code to find sequences of 3, where the array contains card objects with .value and .suit. For simplicity in this question I just put "2h" etc here:
private var _pokerHand = [1h,2h,3c,3h,4c];
private function getAllStraights(): Array
{
var foundStraights:Array = new Array();
for (var i: int = 0; i < (_handLength - 2); i++)
{
if ((_pokerHand[i].value - _pokerHand[i + 1].value) == 1 && (_pokerHand[i + 1].value - _pokerHand[i + 2].value) == 1)
{
trace("found a straight!");
foundStraights.push(new Array(_pokerHand[i], _pokerHand[i + 1], _pokerHand[i + 2]));
}
}
return foundStraights;
}
but it of course fails when there are value duplicates (like the 3's above). I cannot discard duplicates because they could be of different suits. I need every possible straight as in the example above. This allows me to run the straights through a "Flush" function to find "straight flush".
What array iteration technique am I missing?
This is an interesting problem. Given the popularity of poker games (and Flash) I'm sure this has been solved many times before, but I couldn't find an example online. Here's how I would approach it:
Look at it like a path finding problem.
Begin with every card in the hand as the start of a possible path (straight).
While there are possible straights:
Remove one from the list.
Find all the next valid steps, (could be none, or up to 4 following cards with the same value), and for each next valid step:
If it reaches the goal (completes a straight) add it to a list of found straights.
Otherwise add the possible straight with the next step back to the stack.
This seems to do what you want (Card object has .value as int):
private function getAllStraights(cards:Vector.<Card>, straightLength:uint = 3):Vector.<Vector.<Card>> {
var foundStraights:Vector.<Vector.<Card>> = new <Vector.<Card>>[];
var possibleStraights:Vector.<Vector.<Card>> = new <Vector.<Card>>[];
for each (var startingCard:Card in cards) {
possibleStraights.push(new <Card>[startingCard]);
}
while (possibleStraights.length) {
var possibleStraight:Vector.<Card> = possibleStraights.shift();
var lastCard:Card = possibleStraight[possibleStraight.length - 1];
var possibleNextCards:Vector.<Card> = new <Card>[];
for (var i:int = cards.indexOf(lastCard) + 1; i < cards.length; i++) {
var nextCard:Card = cards[i];
if (nextCard.value == lastCard.value)
continue;
if (nextCard.value == lastCard.value + 1)
possibleNextCards.push(nextCard);
else
break;
}
for each (var possibleNextCard:Card in possibleNextCards) {
var possibleNextStraight:Vector.<Card> = possibleStraight.slice().concat(new <Card>[possibleNextCard]);
if (possibleNextStraight.length == straightLength)
foundStraights.push(possibleNextStraight);
else
possibleStraights.push(possibleNextStraight);
}
}
return foundStraights;
}
Given [1♥,2♥,3♣,3♥,4♣] you get: [1♥,2♥,3♣], [1♥,2♥,3♥], [2♥,3♣,4♣], [2♥,3♥,4♣]
It gets really interesting when you have a lot of duplicates, like [1♥,1♣,1♦,1♠,2♥,2♣,3♦,3♠,4♣,4♦,4♥]. This gives you:
[1♥,2♥,3♦], [1♥,2♥,3♠], [1♥,2♣,3♦], [1♥,2♣,3♠], [1♣,2♥,3♦], [1♣,2♥,3♠], [1♣,2♣,3♦], [1♣,2♣,3♠], [1♦,2♥,3♦], [1♦,2♥,3♠], [1♦,2♣,3♦], [1♦,2♣,3♠], [1♠,2♥,3♦], [1♠,2♥,3♠], [1♠,2♣,3♦], [1♠,2♣,3♠], [2♥,3♦,4♣], [2♥,3♦,4♦], [2♥,3♦,4♥], [2♥,3♠,4♣], [2♥,3♠,4♦], [2♥,3♠,4♥], [2♣,3♦,4♣], [2♣,3♦,4♦], [2♣,3♦,4♥], [2♣,3♠,4♣], [2♣,3♠,4♦], [2♣,3♠,4♥]
I haven't checked this thoroughly but it looks right at a glance.
I have two arrays as below.
bulkSheet[] - Original array
resultsArray[] - Checking array
I am comparing first element of 'bulkSheet' array with 'resultArray'. Below code is what I have done so far. It executes fine but take long time and gives Exceeded maximum execution time error.
for(var line in bulkSheet) {
for (var line2 in resultsArray)
{
if(bulkSheet[line][0] == resultsArray[line2][0])
{
// matched items
}
}
}
Is there any fastest way?
Thank you #sandy-good !,
If it is an 1D array we can use indexOf() method.
for(var line in firstArray)
{
var isMatched = secondArray.indexOf(firstArray[line]);
if (isMatched !== -1)
{
var matchedValFromArray2 = secondArray[isMatched]
};
}
If you want to compare 2D array (or two rows of a spreadsheet), you can use .join() method.
for(var i in firstArray)
{
var duplicate = false;
for(var j in secondArray)
{
if(firstArray[i].join() == secondArray[j].join())
{
var matchedValFromArray2 = firstArray[i];
break;
}
}
}
I have a problem with generation of an array of substrings from a string in the following code
var primers=[String]()
var lengthOfPrimer = 20
var lentghOfText = str1.characters.count
var rest = lentghOfText - lengthOfPrimer
for var i = 0; i <= str1.characters.count; ++i
{
var temp = rest - i
var substring1 = str1.substringWithRange(Range<String.Index>(start: advance(str1.startIndex, i), end: advance(str1.endIndex, -temp)))
primers.append(substring1)
}
In playground I have the following error at the line with the substring1 code – Execution was interrupted: reason: EXC_BAD_INSTRUCTION (code=EXC 1386_INVOP, subcode=0x0.
In spite of error sign, I can see in playground the generated set of substrings in loop, but when I tried to use this code in program this code also did not work, What is wrong? What should I do?
Your error is coming from trying to advance the endIndex.
But how about something a little simpler? (Swift 2)
var first = str1.startIndex
var last = advance(first, 20 - 1, str1.endIndex)
while last != str1.endIndex {
primers.append(str1[first++ ... last++])
}
print("\n".join(primers))
// output:
// ACAAGATGCCATTGTCCCCC
// CAAGATGCCATTGTCCCCCG
// AAGATGCCATTGTCCCCCGG
// AGATGCCATTGTCCCCCGGC
// GATGCCATTGTCCCCCGGCC
// ATGCCATTGTCCCCCGGCCT
// TGCCATTGTCCCCCGGCCTC
// GCCATTGTCCCCCGGCCTCC
// CCATTGTCCCCCGGCCTCCT
// CATTGTCCCCCGGCCTCCTG
// ATTGTCCCCCGGCCTCCTGC
// TTGTCCCCCGGCCTCCTGCT
// ...
Or the for loop way:
for var first = str1.startIndex, last = advance(first, 20 - 1, str1.endIndex);
last != str1.endIndex;
++first, ++last
{
primers.append(str1[first...last])
}
for var i = 0; i <= str1.characters.count; ++i
Without getting into the rest of this code, this for loop is wrong. You are reading past the end of the string because you are using <= when you should be using <.
Also you are calling str1.characters.count in the loop even though you have that value in a variable, which is slow.
Try:
for var i = 0; i < lengthOfText; ++i
Okay so this is my code
var no:int = 0;
var elem:int = 0;
loadedData = myLoader.data.split(/\r\n|\n|\r/);
for (var i:int = 0; i < loadedData.length; i++)
{
if (loadedData[i] != '')
{
if (loadedData[i] != ',')
{
if(patterns[no] == undefined) patterns[no] = [];
trace(no);
trace(elem);
obstacleData[i] = loadedData[i].split(",");
trace(patterns[no]);
patterns[no][elem] = obstacleData[i][0];
patterns[no][elem + 1] = obstacleData[i][1];
elem += 2;
trace('Pattern' , no, ': ', patterns[no]);
}
else if (loadedData[i] == ',')
{
no += 1;
elem = 0;
patterns[no] = 0;
}
}
}
The problem is at this line
patterns[no][elem] = obstacleData[i][0];
I'm getting the error: [Fault] exception, information=ReferenceError: Error #1056: Cannot create property 0 on Number.
I've read around on this and multidimensional arrays just seem to be so much more complicated on AS3 compared to other languages where you just create a multidimensional array and it works.
I feel like I've done something really obvious wrong and will feel like an idiot upon someone telling me but I really need help on this one since I'm new to this whole AS3 way of creating multidimensional arrays.
Just in case the output for the code when run is as so:
0
0
Pattern 0 : 300,60
0
2
300,60
Pattern 0 : 300,60,350,90
1
0
0 <--- This might be the problem?
[Fault] exception, information=ReferenceError: Error #1056: Cannot create property 0 on Number.
Maybe the error is caused by the line
patterns[no] = 0;
I think you want to assign an empty array or maybe null and check for null later.